ID: 1129723512

View in Genome Browser
Species Human (GRCh38)
Location 15:77890349-77890371
Sequence TGGGCTACCCAGGCCCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129723512_1129723516 -6 Left 1129723512 15:77890349-77890371 CCCTGATGGGCCTGGGTAGCCCA No data
Right 1129723516 15:77890366-77890388 AGCCCAGAGGTTCACTAGCAAGG No data
1129723512_1129723521 23 Left 1129723512 15:77890349-77890371 CCCTGATGGGCCTGGGTAGCCCA No data
Right 1129723521 15:77890395-77890417 AGGTTTCCTGGTGCACCCCCCGG No data
1129723512_1129723520 11 Left 1129723512 15:77890349-77890371 CCCTGATGGGCCTGGGTAGCCCA No data
Right 1129723520 15:77890383-77890405 GCAAGGACACTGAGGTTTCCTGG No data
1129723512_1129723519 3 Left 1129723512 15:77890349-77890371 CCCTGATGGGCCTGGGTAGCCCA No data
Right 1129723519 15:77890375-77890397 GTTCACTAGCAAGGACACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129723512 Original CRISPR TGGGCTACCCAGGCCCATCA GGG (reversed) Intergenic
No off target data available for this crispr