ID: 1129725139

View in Genome Browser
Species Human (GRCh38)
Location 15:77897827-77897849
Sequence CCAGGTGCAGCCCTGTGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 5, 2: 2, 3: 45, 4: 392}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129725139_1129725148 19 Left 1129725139 15:77897827-77897849 CCGCAGCACAGGGCTGCACCTGG 0: 1
1: 5
2: 2
3: 45
4: 392
Right 1129725148 15:77897869-77897891 CATCTTGCCCGCCAACCTGTTGG No data
1129725139_1129725149 22 Left 1129725139 15:77897827-77897849 CCGCAGCACAGGGCTGCACCTGG 0: 1
1: 5
2: 2
3: 45
4: 392
Right 1129725149 15:77897872-77897894 CTTGCCCGCCAACCTGTTGGTGG 0: 1
1: 1
2: 6
3: 6
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129725139 Original CRISPR CCAGGTGCAGCCCTGTGCTG CGG (reversed) Intergenic
900126899 1:1072760-1072782 CCCGGTGCAGCCATGTGATGGGG - Intronic
900243551 1:1627739-1627761 CCACGTGCAGTGCTGTGCTCTGG - Exonic
900369233 1:2324017-2324039 CCACCTCCAGCCCTGGGCTGCGG + Intronic
900575442 1:3380197-3380219 CCAGGAGAAGCCCTGGTCTGAGG - Intronic
900656843 1:3762806-3762828 CCTGCTGCAGCCCTGACCTGGGG + Intronic
900794036 1:4697301-4697323 CCATTGCCAGCCCTGTGCTGTGG - Intronic
900900952 1:5515489-5515511 ACAAGTGAAGTCCTGTGCTGTGG - Intergenic
901223342 1:7596517-7596539 CCACTCACAGCCCTGTGCTGTGG + Intronic
901306187 1:8234754-8234776 CCAGGTGGGGTCCTGGGCTGGGG - Intergenic
902229969 1:15021618-15021640 CCAGGGGCAGTCCTGAGCCGGGG + Intronic
902649825 1:17829842-17829864 CCAGGGGCAGCCAGGTGCAGAGG + Intergenic
903357468 1:22756713-22756735 GCAGGTGCCGCCTTGTTCTGGGG - Intronic
903568348 1:24285609-24285631 CAAGGCCCAGCCCTCTGCTGTGG + Intergenic
903861514 1:26367564-26367586 GCAGGTGCAGCCCGGTGCCCTGG + Intronic
904337625 1:29808505-29808527 CCATGTGCTGCCCTGTACTCAGG - Intergenic
905138219 1:35817930-35817952 CCAGGTATTGCCCTGTGCTCTGG + Intronic
906072329 1:43026113-43026135 CCATGTGCACCCCACTGCTGAGG - Intergenic
906681003 1:47725395-47725417 CCAGATCCAGCCTTGGGCTGGGG - Intergenic
906747033 1:48229206-48229228 CCAGAGGCAGTGCTGTGCTGTGG - Intronic
907243514 1:53093335-53093357 CCAGGCTCAGCCCTGGGCCGGGG - Intronic
908551510 1:65213383-65213405 CCAGGTTCTGTGCTGTGCTGGGG + Intronic
913538586 1:119797531-119797553 CCTGGAGCAGGCCTGGGCTGAGG - Intronic
915288407 1:154867390-154867412 CCAGGTGCTGCCCTCCGCTGGGG + Intronic
915466975 1:156103740-156103762 CCAGATGTGGCCCTGTGATGTGG - Intronic
916787818 1:168098996-168099018 CTAGGAGCAGACCTGTGATGTGG - Intronic
920441917 1:205986446-205986468 CCAGGGGGAGCACTGAGCTGGGG - Intronic
922471457 1:225879753-225879775 CCAGGTGAAGTCCTTTGCTTGGG - Intronic
922574631 1:226653672-226653694 CCAGGGGCACCCCTGCGTTGTGG - Intronic
923689229 1:236176552-236176574 CCCTGCACAGCCCTGTGCTGGGG - Intronic
924225338 1:241917299-241917321 CCATGTGAGGCACTGTGCTGGGG - Intergenic
1062858434 10:791235-791257 CCAGGCCCGGCCCTGTGCTCAGG - Intergenic
1064018064 10:11788030-11788052 GCAGGTGCAGCTCTGTGCCAGGG - Intergenic
1064971682 10:21073023-21073045 ACTGGTGGAGCCCTGTGCTGTGG - Intronic
1065298697 10:24301484-24301506 CCAGGTGCAGCATAGTGCTCAGG + Intronic
1065353423 10:24815951-24815973 CCAGGTGCAGTGCTGGGCTCCGG + Intergenic
1065602799 10:27387075-27387097 TCAGGAACAGCCCTGTGATGGGG + Intergenic
1067324437 10:45253572-45253594 CCAGGCACATCCCAGTGCTGAGG + Intergenic
1069776203 10:70928715-70928737 TCTGATGCAGCCCTGAGCTGGGG - Intergenic
1069930605 10:71878994-71879016 CCAGGTGCAGCCATGTGCGGTGG - Intergenic
1070484125 10:76913405-76913427 CCACGTGCAGCCCTGCACTCTGG - Intronic
1070717290 10:78732010-78732032 CCATTTGCAGCCCTGAGCAGTGG + Intergenic
1070968222 10:80543009-80543031 CCAGATGCAGCCCTGGCCTGGGG + Intronic
1071509638 10:86253507-86253529 CAATGTACAGCTCTGTGCTGAGG - Intronic
1072533928 10:96345417-96345439 CCAGGTGCTTCCCTGTGGTCAGG + Exonic
1072539095 10:96384821-96384843 GCAGGTGCAGCAGTGTGCTGGGG - Intronic
1073590885 10:104756642-104756664 CCAGGTTCTGCCCCTTGCTGTGG - Intronic
1073682123 10:105716137-105716159 CCTGGAGCCTCCCTGTGCTGGGG + Intergenic
1074535310 10:114324804-114324826 TCAGGTGGACCCCTGTGCTTTGG + Intronic
1075101851 10:119511744-119511766 CCATGGGCATCCCTGTGCTGTGG - Intronic
1075646085 10:124097457-124097479 CCAGGTGCAGCCCTTTTCAGTGG - Intergenic
1075695962 10:124435506-124435528 CCAGGTGCTACCCTGGGCTCTGG - Intergenic
1075746530 10:124732008-124732030 CCAGGATCAGCCCTGAGCAGAGG + Intronic
1076405160 10:130206770-130206792 CCATCTGCAGACCTGAGCTGAGG - Intergenic
1076600244 10:131652673-131652695 CCAGGTACCGCCTTGTGGTGGGG - Intergenic
1076692249 10:132229857-132229879 CCGGCTGCAGCACTGTGGTGCGG + Intronic
1076842565 10:133052977-133052999 CCATCTGCTCCCCTGTGCTGGGG - Intergenic
1076869680 10:133187239-133187261 CCAGGGGCAGCACTGGGCTGGGG - Intronic
1077034231 11:487183-487205 CCTGGTGCAGAGATGTGCTGAGG + Intronic
1077321696 11:1945808-1945830 CCAGCTCCATCCCTGTCCTGCGG + Intergenic
1077496685 11:2890065-2890087 CCAGGTGGTGCCCTGTGGAGAGG + Intronic
1078476170 11:11632412-11632434 CCAGATGCAGCCTGGGGCTGGGG + Intergenic
1078549323 11:12269539-12269561 CCAGAGGGAGCCATGTGCTGAGG + Intergenic
1079434907 11:20438223-20438245 CCAGGGTCAGGCCAGTGCTGTGG - Intronic
1080397469 11:31903156-31903178 CCAGGTGAAGGCGTGTGATGTGG - Intronic
1082009203 11:47438868-47438890 CCCGCTGCAGCCCTTTGCTGCGG + Exonic
1083559150 11:63658141-63658163 CCAGTGGCAGCCGGGTGCTGTGG - Intronic
1084326369 11:68402705-68402727 CCAGGTGCAGCAATGGGCGGAGG - Intronic
1084506627 11:69572587-69572609 CTAGGGGCAGCCTTTTGCTGAGG - Intergenic
1084684953 11:70687965-70687987 CCAGGAGCCTCCCTGTGGTGAGG + Intronic
1085012987 11:73154229-73154251 CCTGGTGCAGGCCTGTTCTCTGG - Intergenic
1085018355 11:73189826-73189848 CCAGGGGCAGCCCTGTGAACTGG + Intergenic
1085409467 11:76282630-76282652 CCTGGTGCAGCCTTGGGGTGTGG + Intergenic
1090400454 11:126445345-126445367 CCAGGCGCAGCCCTGTGGGCTGG + Intronic
1091250817 11:134142280-134142302 TCTGGTGCAGCCCTGCACTGAGG - Intronic
1202804714 11_KI270721v1_random:1121-1143 CCAGCTCCATCCCTGTCCTGCGG + Intergenic
1091450656 12:570324-570346 TTAGGTGCAGCCCTGCTCTGCGG + Intronic
1091996234 12:4996360-4996382 AGAGGTGCAGGCCTTTGCTGGGG + Intergenic
1092525844 12:9309965-9309987 GCAGCTGCTGGCCTGTGCTGGGG + Intergenic
1092715905 12:11390389-11390411 CCAGTTGCAGCCCTGGTCTCTGG - Intronic
1094045101 12:26158689-26158711 GCAGGAGCAGCCCTGCCCTGAGG - Intronic
1094540887 12:31362552-31362574 ACAGGTGGAGCTCTGTCCTGTGG - Intergenic
1095749045 12:45690951-45690973 CTATGTGCAGCGCTGTGCTGGGG + Intergenic
1096209120 12:49749347-49749369 CCAGATGCAGCCCCGTCTTGAGG - Intronic
1097145339 12:56935960-56935982 TCAGGCCCAGGCCTGTGCTGGGG - Intergenic
1099712185 12:86242067-86242089 CCAGTTGCCTCCCTTTGCTGGGG + Intronic
1100834766 12:98555783-98555805 CCACATGCAGCCGTGGGCTGCGG + Intergenic
1102006985 12:109595415-109595437 CCTGGTGCAGGGCTGGGCTGTGG + Intronic
1103339423 12:120213605-120213627 CCCAGTCCAGCCCTGTGCAGCGG - Intronic
1103908137 12:124337788-124337810 CCAGCCCCAGCCCTGTGCAGGGG - Intronic
1103910955 12:124351945-124351967 CCAGGTGCTGCCCTCTGCCAGGG - Intronic
1103966104 12:124640720-124640742 GCAGATGAAGCTCTGTGCTGTGG - Intergenic
1104277514 12:127343194-127343216 CTTTATGCAGCCCTGTGCTGAGG - Intergenic
1104785061 12:131443930-131443952 CCAGGCCCAGGCTTGTGCTGAGG + Intergenic
1104789633 12:131473432-131473454 CCAGGTGGAGCCCTTGTCTGCGG - Intergenic
1104901286 12:132190729-132190751 CGAGGTGCAGAGCTGTGCTGAGG - Intergenic
1105600061 13:21878726-21878748 CCATCTGCAGCCCTGTGCCGGGG + Intergenic
1105634436 13:22203710-22203732 CCAGGTGCTTCCATTTGCTGAGG + Intergenic
1106582131 13:31027625-31027647 CCTAGTGCAGCCCTGGGCTCTGG + Intergenic
1107732783 13:43365414-43365436 ACAGGTGTAGTCCTGGGCTGAGG + Intronic
1108531567 13:51331688-51331710 CCAGGTGATGCCATGGGCTGTGG - Intergenic
1112033723 13:95478912-95478934 GCAGTTGCAGCCCTGTGCCAGGG - Intronic
1112454145 13:99543009-99543031 ACAGGTGCAGCAGAGTGCTGAGG - Intronic
1113309467 13:109116759-109116781 CTAGGTGCAGCCATAGGCTGGGG - Intronic
1113617312 13:111690032-111690054 CCAGGGGCAGGCTTGAGCTGGGG - Intergenic
1113622841 13:111775302-111775324 CCAGGGGCAGGCTTGAGCTGGGG - Intergenic
1113638529 13:111939446-111939468 GCAGGCACAGCCCTGGGCTGGGG + Intergenic
1113743098 13:112724658-112724680 GAAGCTGCAGCCCTGTCCTGGGG + Intronic
1113804526 13:113105695-113105717 CCAGGTGCAGCTCTCAGCTGGGG + Intergenic
1113922060 13:113918757-113918779 CCGTGTCCAGCCCTGTGATGGGG + Intergenic
1115271337 14:31556934-31556956 CCAGGTGGAGCTCAGTGCAGTGG - Intronic
1118894273 14:69932563-69932585 ACAGGTGCAGCCCTCTCCTCCGG + Intronic
1119728903 14:76938696-76938718 CCACTTTCACCCCTGTGCTGGGG + Intergenic
1120145955 14:80978591-80978613 CCATGCTCAGCCCTGGGCTGTGG + Intronic
1120761674 14:88291019-88291041 CCAGGTGCTGCCCTTTTCCGCGG - Intronic
1121640474 14:95481722-95481744 ACAGGGGCAGCCCTGGCCTGGGG - Intergenic
1122422471 14:101586397-101586419 CAAGGTGTTGCCCTGTGCTGTGG - Intergenic
1122652028 14:103231407-103231429 CCAGGAACTGCCCTGTGCTCGGG + Intergenic
1122945644 14:105007500-105007522 CCAAGTGCAGCCCTCAGTTGAGG - Intronic
1123014034 14:105365103-105365125 GCAGCTCCAGCCCTTTGCTGAGG + Intronic
1126683858 15:51230216-51230238 CCAGGAGGAGCTCTGGGCTGGGG - Intronic
1128094313 15:64942395-64942417 CCAGCTGCAGGCTGGTGCTGGGG - Intronic
1128376314 15:67078734-67078756 CCAGGGGCAGCCTATTGCTGCGG + Intronic
1128512921 15:68324859-68324881 CCCTGTGCTCCCCTGTGCTGGGG + Intronic
1129231363 15:74198946-74198968 CCAGGGCCAGCCCTGAGCTCAGG - Intronic
1129458654 15:75689045-75689067 CCAGTCGCAACCCTGTGCTGCGG + Exonic
1129725139 15:77897827-77897849 CCAGGTGCAGCCCTGTGCTGCGG - Intergenic
1129827665 15:78645184-78645206 CCAGGGACAGCCCTATGCTCTGG + Intronic
1130273196 15:82463033-82463055 CCAGATGCAGCCCTGTGCTGCGG - Intergenic
1130465548 15:84190404-84190426 CCAGATGCAGCCCTGTGCTGCGG - Intergenic
1130487144 15:84404416-84404438 CCAGATGCAGCCCTGTGCTGCGG + Intergenic
1130498717 15:84483132-84483154 CCAGATGCAGCCCTGTGCTGCGG + Intergenic
1130587837 15:85194999-85195021 CCAGATGCAGCCCTGTGCTGCGG - Intergenic
1130903798 15:88226199-88226221 GCAGGTGCTGCCCTGGGCTTAGG - Intronic
1131146488 15:90017048-90017070 CCAGCTGCTGCCAGGTGCTGAGG + Intronic
1131406857 15:92172008-92172030 CCAAGCGCAGGCCTGTGATGAGG + Intronic
1131543078 15:93290742-93290764 GCAGGTGCAGCTCTGTGCATTGG + Intergenic
1132570254 16:641260-641282 CTGGGGGCATCCCTGTGCTGGGG - Intronic
1132570309 16:641412-641434 CCGGGGGCATCCCTGTGCTGGGG - Intronic
1132572679 16:650873-650895 CCAGAGGCAGCCCTGGGGTGGGG + Intronic
1132661413 16:1063100-1063122 CCATGAGCAGCCCTGGGCTCTGG + Intergenic
1132722877 16:1325663-1325685 CCAGGTCCAGACCAGGGCTGGGG + Exonic
1132945006 16:2527762-2527784 CCAGGTGCAGCCCTGGGAGGAGG - Exonic
1134044554 16:11091649-11091671 TCAGGTTAAGCCATGTGCTGAGG - Intronic
1134510972 16:14846579-14846601 CCAGGGGCTGCCCTTTGCTGAGG - Exonic
1134698615 16:16245070-16245092 CCAGGGGCTGCCCTTTGCTGAGG - Exonic
1134973220 16:18549603-18549625 CCAGGGGCTGCCCTTTGCTGAGG + Exonic
1136276121 16:29180404-29180426 CCAGGTGCAGCACGGAGCTAAGG + Intergenic
1136394197 16:29984011-29984033 GCCTGTGGAGCCCTGTGCTGGGG + Intronic
1137561830 16:49507492-49507514 ACAGCTGCAGCCCTGACCTGTGG - Intronic
1138635224 16:58332961-58332983 ACAGATGCAGCCGGGTGCTGTGG - Intronic
1138660655 16:58515273-58515295 CCAGGTACAGCCCTGGCCTTCGG - Intergenic
1140151073 16:72366515-72366537 CCAGGTATAGCCATGTGATGAGG - Intergenic
1141160890 16:81628373-81628395 CCAGCTGCAGCCTTGTGCTAAGG - Intronic
1141464916 16:84199020-84199042 CCAGCTGCAGCCCTGGGTGGTGG - Intergenic
1141675312 16:85514433-85514455 CCAGGAGCTGCCCTGGGGTGGGG - Intergenic
1142002714 16:87672480-87672502 TCATGTGCGGCTCTGTGCTGAGG - Intronic
1142003681 16:87679075-87679097 CCAGGCGCAGACCTGGGCAGTGG + Intronic
1142032557 16:87845808-87845830 GCAGCCACAGCCCTGTGCTGGGG - Intronic
1142080498 16:88146462-88146484 CCAGGTGCAGCACAGAGCTAAGG + Intergenic
1142171173 16:88623624-88623646 CCAGACCCAGCCCTGTCCTGTGG + Intronic
1142425767 16:90001524-90001546 CCAGGGGCAGCCACGTGCTGGGG - Intergenic
1142721238 17:1777305-1777327 CAGGCTGCAGCCCTGGGCTGGGG - Exonic
1144216433 17:13059382-13059404 CCAGTCGCAGCCCTGGGCTTTGG - Intergenic
1144667646 17:17112707-17112729 CCAGTTGCAGCCCTGTCCTCAGG - Intronic
1144749562 17:17639054-17639076 CCATGTGAAGCCCTGTGCCATGG + Intergenic
1147310214 17:39591595-39591617 CCAGGGCCTGCCCTTTGCTGGGG + Intergenic
1147741842 17:42674476-42674498 CCCTGAGCAGCCCTGTCCTGAGG - Intronic
1147945674 17:44078861-44078883 CCAGCTGCAGCCCTTGGATGAGG - Exonic
1148082963 17:44977631-44977653 CAAGGTGCAGGCCTGTGCATGGG - Intergenic
1149650924 17:58275901-58275923 CCAGCAGCGGCCCTGAGCTGAGG - Intronic
1151938975 17:77281238-77281260 CCAGGTGCAGCGCAGCGCAGGGG + Intronic
1152132198 17:78484426-78484448 CCAGGGGCATCTCTCTGCTGGGG + Intronic
1152365522 17:79854176-79854198 AAAGGTGCAGCCCAGTCCTGAGG + Intergenic
1152458655 17:80430093-80430115 CCTGGTGCTGGGCTGTGCTGCGG - Intronic
1152461700 17:80445295-80445317 CCAGGTGCCTGCCAGTGCTGGGG - Intergenic
1152657008 17:81524402-81524424 CCAGGTGCAGACCTCAGCTTGGG + Intergenic
1152734650 17:81991466-81991488 CCAGGTGGAGCACTGGCCTGTGG + Intronic
1152735581 17:81995431-81995453 CCAGGCCCAGCACTGTCCTGAGG + Intronic
1152736314 17:81999031-81999053 CCAGGTGCAGGGCTCTGATGCGG - Intronic
1152867410 17:82732464-82732486 CCAGGCTCAGCTCTGTCCTGTGG + Intergenic
1153809665 18:8740880-8740902 CCAGGTGCTGCCTTGGGCTATGG - Intronic
1153815295 18:8785509-8785531 CCAGCTGCCGCCCTGGACTGTGG + Intronic
1160368260 18:78348422-78348444 GCAGGTGCTGCTCGGTGCTGAGG - Intergenic
1160563975 18:79775654-79775676 ACAGCTGCGTCCCTGTGCTGAGG + Intergenic
1160659691 19:292141-292163 CCAGGCGCAGCCCTGTGCCCAGG + Intergenic
1160786839 19:904105-904127 CCATGGTCAGCCCTGTGGTGTGG - Intronic
1160855577 19:1215681-1215703 CAAGAGGCAGCCCTGAGCTGGGG + Intronic
1160923572 19:1532146-1532168 CAAGCGGCAGCCCTGTGCTTTGG + Intronic
1161337352 19:3721729-3721751 GCAGGTGCAGCCGGGAGCTGCGG + Exonic
1161343065 19:3753186-3753208 GGAGGGGCAGCCCTGGGCTGGGG + Intronic
1162496914 19:11028519-11028541 CCAGGTCCAGGCCTGACCTGTGG - Intronic
1162898249 19:13778299-13778321 CTAGGTGAAGCCCAGTGCTGGGG - Exonic
1163390226 19:17026428-17026450 CCAGGTCCAGCCCAGCGCGGAGG + Intronic
1163505807 19:17705477-17705499 CCGGGTGTAGCCCTGAGCTAGGG - Intergenic
1163546144 19:17942491-17942513 CCCGGTGCTGCCCTGGGCGGGGG - Intronic
1163772823 19:19201084-19201106 CCAGGTGCAGCCGGGTGTGGTGG - Intronic
1164160085 19:22620622-22620644 CCATGTGGAGCCCTATGGTGAGG + Intergenic
1164598843 19:29547847-29547869 CCTGCTGCAGCCATGTGCTCTGG - Intronic
1164783719 19:30913085-30913107 AGAGGGGCAGCCCTGTGCTTTGG - Intergenic
1165072234 19:33262057-33262079 CCAGGTACAGGCCTCAGCTGGGG - Intergenic
1165740426 19:38202030-38202052 CCAGCGGCAGGCCTGTGCAGTGG + Intronic
1165949977 19:39468913-39468935 GCAGGTGATGCCCTGGGCTGTGG + Intronic
1168210166 19:54884342-54884364 CCAGTTGCAGCCAGGTGCGGTGG + Intronic
1168421952 19:56210217-56210239 ACAGGTGCACCGCTCTGCTGGGG - Intergenic
1168423509 19:56220533-56220555 ACAGGTGCACCACTCTGCTGGGG + Exonic
1168427263 19:56248839-56248861 ACAGGTGCACCGCTCTGCTGGGG - Intronic
925347360 2:3180259-3180281 CCTGTTGCAGCCTTGTGTTGAGG - Intergenic
925437794 2:3856277-3856299 TTAAGTGGAGCCCTGTGCTGTGG - Intergenic
925842901 2:8009184-8009206 TCAGCTCCAGCCCTGTGCTGAGG - Intergenic
925871757 2:8277944-8277966 GCAGAGGCAGCCCTGTCCTGAGG - Intergenic
926111493 2:10187038-10187060 CCACGTGCAGCCCCGCTCTGTGG + Intronic
926765938 2:16322784-16322806 CCAGGTGGAGCCCTGTCCCTTGG - Intergenic
926892411 2:17649771-17649793 CCCGCTGCAGCACAGTGCTGGGG + Intronic
927704669 2:25289780-25289802 CAAGGAGGAGCCCTCTGCTGTGG + Intronic
927709106 2:25314220-25314242 CCAGGTGTGGCCCTGGGCTGAGG - Intronic
927937739 2:27085068-27085090 CCTCGGGCAGCCCTGGGCTGGGG + Intronic
927945766 2:27134334-27134356 CGATGAGCAGCCCAGTGCTGGGG + Exonic
928375677 2:30771270-30771292 CCAGCTTCAGCCCTGAGCTTTGG + Intronic
928914584 2:36457476-36457498 GCAAGTGCAGCCCTGCCCTGGGG - Intronic
929454942 2:42058887-42058909 CCAGGTCCAACCCTGGGCAGAGG - Intergenic
929545615 2:42853620-42853642 CTACGTGCAGCCGTGGGCTGGGG + Intergenic
929580621 2:43079783-43079805 ACATGTGCAGCCCTGTGCCAGGG + Intergenic
930033320 2:47071100-47071122 CTAGGTGCAGCGCTGGGCTCAGG + Intronic
931246052 2:60493780-60493802 GCAGCTGCTGCCCAGTGCTGTGG + Intronic
932596257 2:73095485-73095507 TCATGTGCAGCCCTCTGCTCAGG - Intronic
932824155 2:74924943-74924965 CAGGGTGCAACCCTGGGCTGTGG + Intergenic
935634031 2:105236312-105236334 CTAGGAACAGCCCTTTGCTGTGG - Intergenic
936075051 2:109396493-109396515 CACGGAGCAGCCCTGTGATGGGG + Intronic
938241065 2:129742585-129742607 CCTGATGGAGCCCTGTGCTAGGG - Intergenic
942548567 2:177090994-177091016 CCAGGTGTGGCCCTGTCCTCTGG - Intergenic
944689574 2:202147420-202147442 TCCTCTGCAGCCCTGTGCTGTGG - Intronic
946189615 2:218001555-218001577 CCAGGTTCGTCTCTGTGCTGAGG - Intronic
947548893 2:231032580-231032602 GTTGGTGCAGCCCTGTCCTGGGG + Intergenic
948381313 2:237551617-237551639 CCAGGAGGTGCCCTCTGCTGAGG + Intronic
948386905 2:237586111-237586133 CTGGGGGCAGCCCTGGGCTGGGG + Exonic
948887511 2:240891563-240891585 CCAGGTCCACCCCTTGGCTGAGG + Exonic
949045044 2:241868716-241868738 CCGGGGGCAGATCTGTGCTGAGG + Intergenic
1168929687 20:1611022-1611044 CAAGGTCCAGCCCTGTGCCTGGG + Intronic
1171156597 20:22880227-22880249 CCAGGTGGATCCCTGTGTTGAGG - Intergenic
1171243131 20:23587462-23587484 GCAGGTACACCCCTGTGGTGTGG + Intergenic
1172385285 20:34529894-34529916 TCAGGGGCAGCCCTGAGCAGGGG - Intronic
1172520548 20:35562808-35562830 CCTGTAGCAGCCCTGGGCTGTGG + Intergenic
1173978413 20:47204727-47204749 CCACGTGGGGCTCTGTGCTGAGG - Intergenic
1174173050 20:48628888-48628910 CCAGATCCAGCCCTGCCCTGAGG + Intronic
1175962633 20:62644861-62644883 CAACGTGCAGCCTGGTGCTGGGG + Intronic
1176298096 21:5085054-5085076 CCTGCTGTATCCCTGTGCTGGGG + Intergenic
1178852861 21:36227736-36227758 CCTGGTGCAGCCTCTTGCTGAGG + Exonic
1179263719 21:39783028-39783050 CCAGGCTCATCCATGTGCTGTGG + Intronic
1179334109 21:40433978-40434000 CCAGGTGAAACCATGTGGTGTGG - Intronic
1179543601 21:42100215-42100237 CCAGTGGGAGCCCTGGGCTGTGG + Intronic
1179630121 21:42672570-42672592 GCAGGTCCAGCTCAGTGCTGGGG + Intronic
1179832202 21:44004062-44004084 CCAAGTGCAGCTCTGTTATGTGG + Intergenic
1179858933 21:44176895-44176917 CCTGCTGTATCCCTGTGCTGGGG - Intergenic
1179985349 21:44917909-44917931 CCTGGTGCTGTCCTGAGCTGAGG - Intronic
1180013339 21:45065560-45065582 CCAGGTGGAGCCCTGAGGTCTGG + Intergenic
1180245791 21:46546471-46546493 GCAGGTGCTGTCCTGTGCTTAGG - Intronic
1180895918 22:19331956-19331978 CCAGGTGCATCCTTGCCCTGGGG - Intronic
1180917473 22:19499175-19499197 GCAGGGTCAGCCCTGTGCTGTGG + Intronic
1180970054 22:19810556-19810578 GCAGGGGCAGCCCCGGGCTGAGG - Intronic
1180988203 22:19917869-19917891 CCCTGTGCAGCCCTGGGCTCTGG + Intronic
1181028593 22:20139312-20139334 CGAGGTAGGGCCCTGTGCTGCGG + Exonic
1181083158 22:20427166-20427188 CCAGGAGCAACCCTGGGCTGTGG + Intronic
1181940601 22:26472921-26472943 ACAGGTGCTGGGCTGTGCTGTGG - Exonic
1182577172 22:31280861-31280883 CCTGCAGCAGCCCTGGGCTGAGG - Intergenic
1183192636 22:36331539-36331561 CCAGGTGCAGACTTCTGCTGGGG + Intronic
1183743338 22:39680036-39680058 CCAGGTGTGGGCCTGTGGTGTGG + Intronic
1183776829 22:39971593-39971615 TAAGGTGCAGCCCAGTGCTGCGG + Exonic
1184187787 22:42876360-42876382 CCCTCTGCCGCCCTGTGCTGAGG - Intronic
1184247982 22:43245286-43245308 CCAGGCGCGGCCCTCTGCTGAGG - Intronic
1184332862 22:43837037-43837059 CCTGCTGTTGCCCTGTGCTGTGG + Intronic
1184456747 22:44615227-44615249 GCAGCTGGAGCCCTTTGCTGGGG - Intergenic
1184786202 22:46673187-46673209 CCAGGTGTTGCCCTGGGCTTGGG - Intronic
1184802579 22:46770539-46770561 CCAAGTGCAGGACTCTGCTGAGG - Intronic
1185260831 22:49861947-49861969 CAGGGTGCAGGCCTGTGCGGGGG - Intronic
1185342291 22:50297076-50297098 CCCGGTGCTGCCCTGTGCTTTGG - Intronic
950107412 3:10396977-10396999 CCCTGTGCAGCACTGTGCTAGGG + Intronic
950136220 3:10582842-10582864 CCAGCTGGAGCCATGTGGTGTGG - Intronic
950418960 3:12885548-12885570 CCAGCTGCAGACCCCTGCTGGGG - Intergenic
950570484 3:13796811-13796833 GCTGGGGGAGCCCTGTGCTGGGG - Intergenic
950965166 3:17140986-17141008 CCAGGAACAGCCCTCTGGTGGGG - Intergenic
951215798 3:20023950-20023972 CCAGCTGCAGCCCTGTGTCTGGG + Intergenic
952725631 3:36581773-36581795 CCAGCAGCAGCCGTGTGATGTGG + Intergenic
953041754 3:39261759-39261781 CCAGGGGCTGCCCAGTGCTTGGG - Intergenic
953853715 3:46485049-46485071 CCAGCTGGGGCCCTGGGCTGTGG - Intronic
954269679 3:49497872-49497894 CCAGGTGCAGACATGTTCTAGGG - Intronic
954429897 3:50464972-50464994 CCATGTGCATCTCTGTCCTGAGG - Intronic
954627230 3:52029136-52029158 CTGGGTGCAGCCTTGGGCTGAGG - Intergenic
954686908 3:52376030-52376052 CCAGGAGGAGCCCTGGGCTCTGG + Intronic
955242819 3:57194436-57194458 CCAGGAGCTGCCTTGTGCTGTGG + Intergenic
956435707 3:69232664-69232686 GCAGGTGCACCCATTTGCTGGGG - Intronic
960057467 3:113285471-113285493 CCAGGAGCAGCCTGCTGCTGTGG + Exonic
960869358 3:122233375-122233397 CCAGTTCCAGCCCAGTCCTGGGG + Intronic
960988352 3:123294993-123295015 CCTTGTGAAGCCCTGGGCTGGGG - Intronic
961074338 3:123967706-123967728 GCAGGTGCAGCCCAGTGCTGTGG + Intergenic
961101363 3:124201951-124201973 CCAGCTGGAGCCCTGTGATGGGG + Intronic
961309291 3:125984429-125984451 GCAGGTGCAGCCCAGTGCTATGG - Intergenic
962943355 3:140145640-140145662 GCAGGAGCAGCCCTGGGCAGAGG - Intronic
963283482 3:143410249-143410271 CTAACTGCAGCCCTGTACTGGGG + Intronic
964032702 3:152155848-152155870 CCCACTGCAGCCCTATGCTGTGG + Intergenic
964414747 3:156435446-156435468 CGAGGTGCTGAGCTGTGCTGGGG - Intronic
964742975 3:159987353-159987375 ACAGGTGCAGAGCTGTGTTGTGG - Intergenic
965906076 3:173708353-173708375 CGTGGTGCAGCACTGAGCTGGGG - Intronic
966100795 3:176267324-176267346 TCAGGTGCACCTCTCTGCTGAGG + Intergenic
966302898 3:178498540-178498562 CCATCTGCAGCTCAGTGCTGAGG + Intronic
967291421 3:187924565-187924587 CCAGGTGCTTCACTATGCTGTGG - Intergenic
968142519 3:196270414-196270436 CAAAGTGCAGCGCTGTGCAGTGG - Exonic
968504429 4:965373-965395 CCTTGGGCAGCCCTGGGCTGGGG - Intronic
968519517 4:1029261-1029283 CCAGGTGCAGCCCCTCCCTGGGG - Intergenic
968552141 4:1229231-1229253 CCAGGTGCAGCACTGGGCACAGG + Intronic
968612613 4:1564008-1564030 CCAGGGGCACCCCAGGGCTGGGG - Intergenic
968727600 4:2255565-2255587 CCCAGTGCAGCCCCGGGCTGAGG - Intronic
968965728 4:3768202-3768224 CCAGAAGCAGCCCCTTGCTGAGG - Exonic
968966661 4:3772349-3772371 GGAGGAGCAGCCCTGTGCGGAGG + Intergenic
968973721 4:3810382-3810404 CCAGGGCCAGGCATGTGCTGGGG + Intergenic
969888028 4:10233993-10234015 CCAGAAGCAGCCCTGTTCTCAGG - Intergenic
970582926 4:17489967-17489989 CCAGGTGCTGCCCTCGGCTCTGG - Intronic
970860278 4:20694603-20694625 CCTGGTACAGTCCTTTGCTGAGG - Intergenic
973068234 4:45823999-45824021 CCATGTGCTGACCAGTGCTGTGG + Intergenic
973981332 4:56310548-56310570 CCAGCTGCACCCCTGTGTAGAGG + Intronic
985111748 4:186553993-186554015 CCTAGTGCAGCCTTGTGCTGTGG - Intronic
985610637 5:886101-886123 GCAGGTGCAGGCCTGTGGTCAGG - Intronic
985817170 5:2135617-2135639 CCAGGCCCAGCACTGTGCTGAGG + Intergenic
986187680 5:5459994-5460016 CCCGGTACAGCCTTGTGCAGGGG - Intronic
986633097 5:9793681-9793703 CCAGATGCAGCCCTGGGGTGCGG + Intergenic
987297580 5:16567629-16567651 CTAGCTACTGCCCTGTGCTGTGG - Intronic
988404432 5:30805807-30805829 CCAGCTGTAGGCCTGTGCCGTGG - Intergenic
988608647 5:32704204-32704226 CCAGCAGCAGCCATGTGGTGTGG - Intronic
990471138 5:56116756-56116778 GCAGCTGCAGCCCAGTGCAGAGG + Exonic
991174203 5:63667842-63667864 GCAGGTGCAACCATGTGCAGAGG + Intergenic
993076997 5:83244710-83244732 CCACCTACATCCCTGTGCTGAGG + Intronic
997211183 5:132077900-132077922 CCAAGTGCAGCCCTGAGCCCAGG + Intergenic
997368548 5:133341423-133341445 CCAGGAGAAGCCGTGTTCTGGGG - Intronic
997641905 5:135454979-135455001 CCAGGTGCAGGCCTGGTCTGGGG - Intergenic
998262091 5:140639424-140639446 CCTGTTCCCGCCCTGTGCTGAGG + Exonic
999244652 5:150147424-150147446 CCCGGAGCAGCCATGGGCTGGGG + Intronic
999255277 5:150206569-150206591 GCAGGTGGAGCCTTGTGGTGGGG - Intronic
999282976 5:150376881-150376903 CCAGGTGCTGCCCTTGTCTGGGG + Intronic
1001690472 5:173629109-173629131 CCACGTGCTACCCTGTGCTAGGG + Intergenic
1001772945 5:174309432-174309454 CCAGGGCCTGGCCTGTGCTGTGG + Intergenic
1001954947 5:175842722-175842744 AGAGGCGCAGGCCTGTGCTGGGG - Intronic
1002101715 5:176861170-176861192 GGGGGTGCAGCCCTTTGCTGTGG + Intronic
1002171441 5:177376995-177377017 CCTGAAGCAGCCCTGGGCTGAGG + Intergenic
1002547069 5:179956206-179956228 CTCTCTGCAGCCCTGTGCTGTGG + Intronic
1002563319 5:180096877-180096899 CCAGGTGCTGGGCTGGGCTGAGG + Intergenic
1002900115 6:1404199-1404221 GGAGATGCTGCCCTGTGCTGTGG - Intergenic
1003320145 6:5043990-5044012 CCCTGTGCGGCCCTGTGGTGTGG + Intergenic
1004306015 6:14502544-14502566 CCAGGTGCACCAGTGTGCTAAGG + Intergenic
1005490006 6:26339055-26339077 CCAGCTGGAGCTCTGTGCTTGGG + Intergenic
1006276641 6:33009509-33009531 CCAGGACCAGCCCTGCTCTGAGG + Exonic
1006609875 6:35287944-35287966 ACAAGGGCAGCCCTGTGCTTGGG + Intronic
1007176845 6:39902965-39902987 TCAAGTGCTGCCCTCTGCTGAGG - Exonic
1007574436 6:42916023-42916045 CCAGCTGCAGACCTGAGTTGCGG - Exonic
1007713300 6:43838495-43838517 CCAGGGGCAGCCTGGGGCTGGGG - Intergenic
1007844559 6:44742522-44742544 CCCAGTGCAGCCCTGAGGTGTGG + Intergenic
1008597992 6:53061956-53061978 CCAGGCGCAGCTCTGGGCCGAGG + Intronic
1013339353 6:109198269-109198291 TCAGGAGCAGCCCTTTGCTTTGG - Intergenic
1013605941 6:111748286-111748308 CCAGCTGCAGCCGTTTCCTGTGG - Intronic
1015965585 6:138693065-138693087 CCAGGGGCAGCTCTGGGCGGCGG + Intergenic
1016934089 6:149436141-149436163 CCCGGGGCTGGCCTGTGCTGTGG + Intergenic
1017809981 6:157977553-157977575 ACAGGTGCCTCTCTGTGCTGGGG + Intergenic
1018753487 6:166828171-166828193 CCAGCTTCAGCACAGTGCTGTGG + Intronic
1018836392 6:167487406-167487428 TCAGGTGCAGCTCTGTGAGGTGG + Intergenic
1018941382 6:168310538-168310560 CCAGGGGAACCCCTGAGCTGAGG + Intronic
1019312298 7:368785-368807 CCAGGCGGGGCTCTGTGCTGCGG - Intergenic
1019338449 7:496039-496061 CCAGGTGCAGCCCAGGGCTAGGG + Intergenic
1019346479 7:533297-533319 CAAGGTGCACCTCTGGGCTGTGG + Intergenic
1019481199 7:1267579-1267601 CCCAGAGCAGCCCTGGGCTGGGG + Intergenic
1019596624 7:1861287-1861309 CCAGGTGGAGCCATGTGCCCAGG - Intronic
1019635320 7:2072392-2072414 CCAGGTGCAGCACTGGCCAGCGG + Intronic
1019716535 7:2541916-2541938 CTAGGTCCTGGCCTGTGCTGTGG - Intronic
1019736922 7:2655035-2655057 CCAAGTGCAGCCCCTTTCTGAGG + Intronic
1020242880 7:6409328-6409350 CCAAGGGCAGCCCTGGGCTCTGG - Exonic
1022977581 7:35573450-35573472 CCAGCTGCAGGTCTGTGATGGGG - Intergenic
1023646154 7:42318228-42318250 CCAGCAGCAGCCATGTGGTGTGG + Intergenic
1024008123 7:45242196-45242218 CCAGGTGCAGAAATGTGCAGTGG + Intergenic
1024059601 7:45687909-45687931 GCAGGTGCAGCCCAGAGTTGGGG + Intronic
1024534553 7:50419150-50419172 CCAGGAGCAGCACTGTGGCGAGG + Intergenic
1026840518 7:73668021-73668043 CCCGGAGCTGCCCGGTGCTGAGG - Exonic
1027146664 7:75700318-75700340 CCAGGTTCAGCCCTGACTTGTGG + Intronic
1027589249 7:80096918-80096940 CAAGATGTAGCCCTGTGCTGGGG - Intergenic
1028582576 7:92422965-92422987 GCAGGTGCAGTCCTGGGCTTAGG + Intergenic
1030006552 7:105126071-105126093 CCACATTTAGCCCTGTGCTGCGG - Intronic
1030105223 7:105981648-105981670 TCAGGTTCTGCCCTGAGCTGTGG + Intronic
1033343175 7:140507485-140507507 CCAGTTGGGGCCCGGTGCTGTGG + Intergenic
1035045799 7:155964581-155964603 CCTGGGCGAGCCCTGTGCTGCGG + Exonic
1035262017 7:157667964-157667986 CTGGGTGCAGCACTGTCCTGCGG - Intronic
1035452820 7:158989439-158989461 CCAAGTCCTGACCTGTGCTGGGG - Intergenic
1035492352 7:159291442-159291464 CCAGTTGAGGCCCTGTGCTGAGG - Intergenic
1035721216 8:1794491-1794513 CCAGGAGCAGCCAGGTGCGGTGG - Intergenic
1037929863 8:22872436-22872458 CTGGCTGCAGCCCTGTGCAGTGG + Intronic
1038583606 8:28770712-28770734 GCAGGTGCAGCCCTGCCCTTGGG - Intronic
1039387324 8:37147605-37147627 CCAGGCTCAGCGCTGTCCTGTGG + Intergenic
1041411696 8:57563390-57563412 CCAGGTCCACCCCAGTTCTGGGG + Intergenic
1045920434 8:107522607-107522629 CCAAGTCCAGCCCTGTGCCCAGG + Intergenic
1048292612 8:133192088-133192110 GCAGGTCCTGCCCTGGGCTGTGG - Intronic
1049239749 8:141531114-141531136 CCAGGGACAGCGCAGTGCTGGGG + Intergenic
1049383744 8:142330621-142330643 CCAGGTGCACCTGTGTGCTAAGG - Intronic
1049422074 8:142521428-142521450 GCAGGTGCAGCCTTTGGCTGGGG + Intronic
1049422096 8:142521538-142521560 CCAGGGCCTGCCATGTGCTGTGG + Intronic
1049551566 8:143262159-143262181 CCAGGTGCAGGTCTGTGAGGAGG + Intronic
1049561943 8:143316439-143316461 CCAGGGGAAGCCGGGTGCTGGGG - Intronic
1049561958 8:143316492-143316514 CCAGGGGAAGCCGGGTGCTGGGG - Intronic
1049561973 8:143316545-143316567 CCAGGGGAAGCCGGGTGCTGGGG - Intronic
1049561988 8:143316598-143316620 CCAGGGGAAGCCAGGTGCTGGGG - Intronic
1049562002 8:143316651-143316673 CCAGGGGAAGCCGGGTGCTGGGG - Intronic
1049641285 8:143717177-143717199 CAAGGCCCACCCCTGTGCTGAGG + Intronic
1049796614 8:144499988-144500010 TGAGGGGCAGCCCTGGGCTGAGG + Intronic
1051371069 9:16359761-16359783 CCTGGTGTAGGCCTGAGCTGGGG - Intergenic
1051395992 9:16621262-16621284 CCTGGTGCTGCCCTGGACTGAGG - Intronic
1051546302 9:18279878-18279900 CCAGGACCAGCCTGGTGCTGGGG + Intergenic
1054792213 9:69266805-69266827 CTAGATGCAGCCGGGTGCTGTGG + Intergenic
1056224271 9:84480189-84480211 CCAGTGGCAGCCATGGGCTGTGG + Intergenic
1056678687 9:88698183-88698205 CCATGTGCAGCCCTGCTATGTGG + Intergenic
1056751316 9:89353460-89353482 TCAGCTGCAGCCCTCTGGTGAGG - Intronic
1056831090 9:89918142-89918164 CCAGGTGCTGCTCTGGGATGGGG - Intergenic
1056942863 9:90970162-90970184 CTGGGTGCAGCCTGGTGCTGAGG - Intergenic
1057178979 9:93019630-93019652 CCATGTGGAGCCCTCTGCAGTGG - Intronic
1057198813 9:93129735-93129757 CCTGGGGCAGCCCTATGCTTTGG - Intronic
1057566528 9:96170047-96170069 CCTGGTGCAGCCCTGTGGGCTGG - Intergenic
1059305207 9:113348602-113348624 CCAGATTGAGCCCTCTGCTGGGG - Intergenic
1060658492 9:125388819-125388841 ACAGGTGGACCCCTGTGGTGGGG + Intergenic
1061215811 9:129221425-129221447 CTGGGGGCAGCCCTGTGCAGAGG + Intergenic
1061264524 9:129497424-129497446 GCAGCCGCAGCCCTGTTCTGGGG + Intergenic
1061886509 9:133593714-133593736 CCAAGCACAGCCCGGTGCTGGGG + Intergenic
1061937666 9:133867193-133867215 CCAGCTGCAGACCTGCTCTGAGG - Intronic
1062253095 9:135608140-135608162 CCAGGCCCAGCCCCATGCTGCGG - Intergenic
1062323302 9:136001045-136001067 ACAGGTGCAGGCCCCTGCTGGGG + Intergenic
1062323693 9:136002830-136002852 CCAGGGCCACCCCTGGGCTGAGG + Intergenic
1062457707 9:136647230-136647252 CCAGGAGCTGCCCTTGGCTGAGG + Intergenic
1062531623 9:137003738-137003760 CCAGGATCAGCCAGGTGCTGTGG - Intergenic
1062653381 9:137589989-137590011 CCAGGTGCACCCCAGAGCCGAGG + Intronic
1185757750 X:2665451-2665473 CAGGGTGCAGCCCTCTGCTCAGG - Intergenic
1186027777 X:5332731-5332753 CCAGGTGCTGGCCTTTGATGAGG + Intergenic
1187286248 X:17906635-17906657 CCAGTTGAAGACATGTGCTGAGG + Intergenic
1188285950 X:28325786-28325808 CCAGATGTAGCCCTGTGATCTGG - Intergenic
1188736518 X:33723924-33723946 CCATGGGAAGCCCTGTGCTTTGG - Intergenic
1191179086 X:57540365-57540387 CCAGGTGCTGTGCTGTGCTGGGG + Intergenic
1193836177 X:86347370-86347392 GCAAGTGCACCCATGTGCTGAGG - Intronic
1195872252 X:109498664-109498686 CCAGCGGCAGCTGTGTGCTGTGG - Intergenic
1196889995 X:120282560-120282582 TCATGCCCAGCCCTGTGCTGGGG + Intronic
1197775882 X:130118353-130118375 CAAGGGGCAGGCCTGGGCTGAGG + Intergenic
1199849024 X:151712058-151712080 CCAGGTGCACCCATTTGCTTGGG + Intergenic
1199852688 X:151736804-151736826 CCAGGGCCAGGCCAGTGCTGGGG - Intergenic
1200114684 X:153764940-153764962 CCAGGGGCAGGGCTGGGCTGGGG + Intronic
1201651654 Y:16295145-16295167 CCAGGTGCTGCTCTGTCCTAAGG - Intergenic