ID: 1129726779

View in Genome Browser
Species Human (GRCh38)
Location 15:77905527-77905549
Sequence GACCCCTCTGGAGGTACTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129726779_1129726786 0 Left 1129726779 15:77905527-77905549 CCCCAAGTACCTCCAGAGGGGTC No data
Right 1129726786 15:77905550-77905572 CCCCCGCCAGCCCTTGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129726779 Original CRISPR GACCCCTCTGGAGGTACTTG GGG (reversed) Intergenic
No off target data available for this crispr