ID: 1129731447

View in Genome Browser
Species Human (GRCh38)
Location 15:77934854-77934876
Sequence TGGCCTCTATGGTTTCTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129731447_1129731453 23 Left 1129731447 15:77934854-77934876 CCCTAAAGAAACCATAGAGGCCA No data
Right 1129731453 15:77934900-77934922 ATCAATAAATCCCCTTGTCCTGG No data
1129731447_1129731454 24 Left 1129731447 15:77934854-77934876 CCCTAAAGAAACCATAGAGGCCA No data
Right 1129731454 15:77934901-77934923 TCAATAAATCCCCTTGTCCTGGG No data
1129731447_1129731450 -9 Left 1129731447 15:77934854-77934876 CCCTAAAGAAACCATAGAGGCCA No data
Right 1129731450 15:77934868-77934890 TAGAGGCCAAGAGCTTAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129731447 Original CRISPR TGGCCTCTATGGTTTCTTTA GGG (reversed) Intergenic