ID: 1129731450

View in Genome Browser
Species Human (GRCh38)
Location 15:77934868-77934890
Sequence TAGAGGCCAAGAGCTTAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129731447_1129731450 -9 Left 1129731447 15:77934854-77934876 CCCTAAAGAAACCATAGAGGCCA No data
Right 1129731450 15:77934868-77934890 TAGAGGCCAAGAGCTTAAGCAGG No data
1129731445_1129731450 -4 Left 1129731445 15:77934849-77934871 CCATGCCCTAAAGAAACCATAGA No data
Right 1129731450 15:77934868-77934890 TAGAGGCCAAGAGCTTAAGCAGG No data
1129731448_1129731450 -10 Left 1129731448 15:77934855-77934877 CCTAAAGAAACCATAGAGGCCAA No data
Right 1129731450 15:77934868-77934890 TAGAGGCCAAGAGCTTAAGCAGG No data
1129731444_1129731450 19 Left 1129731444 15:77934826-77934848 CCTAAGCATGGGACAGAGGGGTA No data
Right 1129731450 15:77934868-77934890 TAGAGGCCAAGAGCTTAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129731450 Original CRISPR TAGAGGCCAAGAGCTTAAGC AGG Intergenic