ID: 1129731453

View in Genome Browser
Species Human (GRCh38)
Location 15:77934900-77934922
Sequence ATCAATAAATCCCCTTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129731447_1129731453 23 Left 1129731447 15:77934854-77934876 CCCTAAAGAAACCATAGAGGCCA No data
Right 1129731453 15:77934900-77934922 ATCAATAAATCCCCTTGTCCTGG No data
1129731445_1129731453 28 Left 1129731445 15:77934849-77934871 CCATGCCCTAAAGAAACCATAGA No data
Right 1129731453 15:77934900-77934922 ATCAATAAATCCCCTTGTCCTGG No data
1129731448_1129731453 22 Left 1129731448 15:77934855-77934877 CCTAAAGAAACCATAGAGGCCAA No data
Right 1129731453 15:77934900-77934922 ATCAATAAATCCCCTTGTCCTGG No data
1129731451_1129731453 3 Left 1129731451 15:77934874-77934896 CCAAGAGCTTAAGCAGGTCTGAC No data
Right 1129731453 15:77934900-77934922 ATCAATAAATCCCCTTGTCCTGG No data
1129731449_1129731453 12 Left 1129731449 15:77934865-77934887 CCATAGAGGCCAAGAGCTTAAGC No data
Right 1129731453 15:77934900-77934922 ATCAATAAATCCCCTTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129731453 Original CRISPR ATCAATAAATCCCCTTGTCC TGG Intergenic