ID: 1129733045

View in Genome Browser
Species Human (GRCh38)
Location 15:77942674-77942696
Sequence GATCAGCACGCTGGCCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129733045_1129733048 -3 Left 1129733045 15:77942674-77942696 CCATCTTGGCCAGCGTGCTGATC No data
Right 1129733048 15:77942694-77942716 ATCTCTGCCAGCACCCAGTCGGG 0: 1
1: 0
2: 3
3: 19
4: 186
1129733045_1129733047 -4 Left 1129733045 15:77942674-77942696 CCATCTTGGCCAGCGTGCTGATC No data
Right 1129733047 15:77942693-77942715 GATCTCTGCCAGCACCCAGTCGG 0: 1
1: 0
2: 2
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129733045 Original CRISPR GATCAGCACGCTGGCCAAGA TGG (reversed) Intergenic
No off target data available for this crispr