ID: 1129734526

View in Genome Browser
Species Human (GRCh38)
Location 15:77952224-77952246
Sequence CCTCACAGGCAGAAAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129734511_1129734526 13 Left 1129734511 15:77952188-77952210 CCCACAGGTGAATGCCCCTCTTT No data
Right 1129734526 15:77952224-77952246 CCTCACAGGCAGAAAGAGGGAGG No data
1129734514_1129734526 -2 Left 1129734514 15:77952203-77952225 CCCTCTTTCCAGCCCCACCCACC No data
Right 1129734526 15:77952224-77952246 CCTCACAGGCAGAAAGAGGGAGG No data
1129734517_1129734526 -10 Left 1129734517 15:77952211-77952233 CCAGCCCCACCCACCTCACAGGC No data
Right 1129734526 15:77952224-77952246 CCTCACAGGCAGAAAGAGGGAGG No data
1129734513_1129734526 -1 Left 1129734513 15:77952202-77952224 CCCCTCTTTCCAGCCCCACCCAC No data
Right 1129734526 15:77952224-77952246 CCTCACAGGCAGAAAGAGGGAGG No data
1129734512_1129734526 12 Left 1129734512 15:77952189-77952211 CCACAGGTGAATGCCCCTCTTTC No data
Right 1129734526 15:77952224-77952246 CCTCACAGGCAGAAAGAGGGAGG No data
1129734515_1129734526 -3 Left 1129734515 15:77952204-77952226 CCTCTTTCCAGCCCCACCCACCT No data
Right 1129734526 15:77952224-77952246 CCTCACAGGCAGAAAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129734526 Original CRISPR CCTCACAGGCAGAAAGAGGG AGG Intergenic
No off target data available for this crispr