ID: 1129734878

View in Genome Browser
Species Human (GRCh38)
Location 15:77954070-77954092
Sequence AAAAGGAAACTTGTGGTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129734878_1129734883 2 Left 1129734878 15:77954070-77954092 CCACTAACCACAAGTTTCCTTTT No data
Right 1129734883 15:77954095-77954117 TCATTTATTTATTTAAGGCAGGG No data
1129734878_1129734885 25 Left 1129734878 15:77954070-77954092 CCACTAACCACAAGTTTCCTTTT No data
Right 1129734885 15:77954118-77954140 TTTTGCTCTGTCACCCAGGCTGG 0: 1239
1: 30279
2: 80504
3: 156878
4: 175890
1129734878_1129734882 1 Left 1129734878 15:77954070-77954092 CCACTAACCACAAGTTTCCTTTT No data
Right 1129734882 15:77954094-77954116 TTCATTTATTTATTTAAGGCAGG No data
1129734878_1129734884 21 Left 1129734878 15:77954070-77954092 CCACTAACCACAAGTTTCCTTTT No data
Right 1129734884 15:77954114-77954136 AGGGTTTTGCTCTGTCACCCAGG 0: 262
1: 5446
2: 24091
3: 70035
4: 135036
1129734878_1129734881 -3 Left 1129734878 15:77954070-77954092 CCACTAACCACAAGTTTCCTTTT No data
Right 1129734881 15:77954090-77954112 TTTATTCATTTATTTATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129734878 Original CRISPR AAAAGGAAACTTGTGGTTAG TGG (reversed) Intergenic
No off target data available for this crispr