ID: 1129737065

View in Genome Browser
Species Human (GRCh38)
Location 15:77972412-77972434
Sequence TGGGCCCCACCCAAGCAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129737051_1129737065 25 Left 1129737051 15:77972364-77972386 CCTGCAGCCTTTGGTCTCCTTGA No data
Right 1129737065 15:77972412-77972434 TGGGCCCCACCCAAGCAGGTTGG No data
1129737050_1129737065 29 Left 1129737050 15:77972360-77972382 CCAGCCTGCAGCCTTTGGTCTCC No data
Right 1129737065 15:77972412-77972434 TGGGCCCCACCCAAGCAGGTTGG No data
1129737056_1129737065 18 Left 1129737056 15:77972371-77972393 CCTTTGGTCTCCTTGATGGGGGT No data
Right 1129737065 15:77972412-77972434 TGGGCCCCACCCAAGCAGGTTGG No data
1129737060_1129737065 8 Left 1129737060 15:77972381-77972403 CCTTGATGGGGGTGGGACAGGAG No data
Right 1129737065 15:77972412-77972434 TGGGCCCCACCCAAGCAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129737065 Original CRISPR TGGGCCCCACCCAAGCAGGT TGG Intergenic
No off target data available for this crispr