ID: 1129737904

View in Genome Browser
Species Human (GRCh38)
Location 15:77976043-77976065
Sequence CCAGGCACAGGCCCCATCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 1, 2: 5, 3: 34, 4: 387}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129737904_1129737914 26 Left 1129737904 15:77976043-77976065 CCATGGATGGGGCCTGTGCCTGG 0: 1
1: 1
2: 5
3: 34
4: 387
Right 1129737914 15:77976092-77976114 GACTTCCCCTTGGTGCTGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 176
1129737904_1129737913 16 Left 1129737904 15:77976043-77976065 CCATGGATGGGGCCTGTGCCTGG 0: 1
1: 1
2: 5
3: 34
4: 387
Right 1129737913 15:77976082-77976104 GGACATCATCGACTTCCCCTTGG 0: 1
1: 1
2: 0
3: 3
4: 62
1129737904_1129737908 -5 Left 1129737904 15:77976043-77976065 CCATGGATGGGGCCTGTGCCTGG 0: 1
1: 1
2: 5
3: 34
4: 387
Right 1129737908 15:77976061-77976083 CCTGGACGACCCTCCTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129737904 Original CRISPR CCAGGCACAGGCCCCATCCA TGG (reversed) Intergenic