ID: 1129737907

View in Genome Browser
Species Human (GRCh38)
Location 15:77976061-77976083
Sequence CCTTGGCAGGAGGGTCGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129737907_1129737913 -2 Left 1129737907 15:77976061-77976083 CCTGGACGACCCTCCTGCCAAGG No data
Right 1129737913 15:77976082-77976104 GGACATCATCGACTTCCCCTTGG 0: 1
1: 1
2: 0
3: 3
4: 62
1129737907_1129737914 8 Left 1129737907 15:77976061-77976083 CCTGGACGACCCTCCTGCCAAGG No data
Right 1129737914 15:77976092-77976114 GACTTCCCCTTGGTGCTGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129737907 Original CRISPR CCTTGGCAGGAGGGTCGTCC AGG (reversed) Intergenic