ID: 1129737910

View in Genome Browser
Species Human (GRCh38)
Location 15:77976071-77976093
Sequence TCGATGATGTCCTTGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 2, 2: 1, 3: 6, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129737910_1129737914 -2 Left 1129737910 15:77976071-77976093 CCTCCTGCCAAGGACATCATCGA 0: 1
1: 2
2: 1
3: 6
4: 101
Right 1129737914 15:77976092-77976114 GACTTCCCCTTGGTGCTGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129737910 Original CRISPR TCGATGATGTCCTTGGCAGG AGG (reversed) Intergenic