ID: 1129737912

View in Genome Browser
Species Human (GRCh38)
Location 15:77976078-77976100
Sequence GGGGAAGTCGATGATGTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129737912_1129737914 -9 Left 1129737912 15:77976078-77976100 CCAAGGACATCATCGACTTCCCC 0: 1
1: 1
2: 1
3: 5
4: 110
Right 1129737914 15:77976092-77976114 GACTTCCCCTTGGTGCTGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129737912 Original CRISPR GGGGAAGTCGATGATGTCCT TGG (reversed) Intergenic