ID: 1129737914

View in Genome Browser
Species Human (GRCh38)
Location 15:77976092-77976114
Sequence GACTTCCCCTTGGTGCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 176}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129737909_1129737914 -1 Left 1129737909 15:77976070-77976092 CCCTCCTGCCAAGGACATCATCG 0: 1
1: 1
2: 1
3: 9
4: 97
Right 1129737914 15:77976092-77976114 GACTTCCCCTTGGTGCTGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 176
1129737907_1129737914 8 Left 1129737907 15:77976061-77976083 CCTGGACGACCCTCCTGCCAAGG No data
Right 1129737914 15:77976092-77976114 GACTTCCCCTTGGTGCTGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 176
1129737904_1129737914 26 Left 1129737904 15:77976043-77976065 CCATGGATGGGGCCTGTGCCTGG 0: 1
1: 1
2: 5
3: 34
4: 387
Right 1129737914 15:77976092-77976114 GACTTCCCCTTGGTGCTGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 176
1129737906_1129737914 14 Left 1129737906 15:77976055-77976077 CCTGTGCCTGGACGACCCTCCTG No data
Right 1129737914 15:77976092-77976114 GACTTCCCCTTGGTGCTGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 176
1129737910_1129737914 -2 Left 1129737910 15:77976071-77976093 CCTCCTGCCAAGGACATCATCGA 0: 1
1: 2
2: 1
3: 6
4: 101
Right 1129737914 15:77976092-77976114 GACTTCCCCTTGGTGCTGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 176
1129737912_1129737914 -9 Left 1129737912 15:77976078-77976100 CCAAGGACATCATCGACTTCCCC 0: 1
1: 1
2: 1
3: 5
4: 110
Right 1129737914 15:77976092-77976114 GACTTCCCCTTGGTGCTGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 176
1129737911_1129737914 -5 Left 1129737911 15:77976074-77976096 CCTGCCAAGGACATCATCGACTT 0: 1
1: 2
2: 2
3: 12
4: 308
Right 1129737914 15:77976092-77976114 GACTTCCCCTTGGTGCTGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129737914 Original CRISPR GACTTCCCCTTGGTGCTGCC TGG Intergenic
901176476 1:7303053-7303075 GCCTTCCTCTTGGTGCTGCTGGG + Intronic
902840366 1:19070394-19070416 GCCATCCTCTTGGTGCTGCTGGG + Intergenic
902962715 1:19976242-19976264 GACTTCCCCTTGTTGCTCATTGG - Intronic
903257533 1:22112939-22112961 GACCTACCCTTGGTGCTTCCTGG - Intergenic
903546580 1:24127703-24127725 GGCTTGCCCTTGGTTGTGCCTGG + Intronic
904310129 1:29623778-29623800 GTCTCCTCCTGGGTGCTGCCTGG + Intergenic
906478191 1:46183902-46183924 GACTTTCCCTCACTGCTGCCAGG - Intronic
906663371 1:47598427-47598449 GACTTCAGCTTTGTGCAGCCAGG + Intergenic
907105421 1:51878443-51878465 GACTTCGCCTTGTTCCTTCCAGG + Exonic
913263954 1:117026254-117026276 GATTTTCCCTTTGTGCTTCCTGG - Intronic
914918137 1:151830810-151830832 CACCTCCCCTTGCTCCTGCCTGG + Intronic
915891917 1:159781119-159781141 AACTTCTCCTGGGTGCTTCCGGG + Exonic
916487566 1:165272952-165272974 TACTTCCCTTTCATGCTGCCAGG - Intronic
917228738 1:172813478-172813500 TACTTCCCTTTGCTGCTGCCAGG - Intergenic
917422674 1:174881205-174881227 GAATTCCCTTTGGTGCAGCTAGG - Intronic
919879012 1:201889866-201889888 GCCCTCCCTTTGGTCCTGCCAGG + Intronic
922546470 1:226461213-226461235 GACTCTCCCTTGGAGCTGTCTGG + Intergenic
924056211 1:240126978-240127000 GACTTGCCCTGGGAGCTGCCTGG - Intronic
924807926 1:247376101-247376123 GGCTTCACCTTGCTGCTGCCTGG - Intergenic
1063254913 10:4316668-4316690 GAAGTGCCCTTGGTTCTGCCAGG - Intergenic
1067292638 10:44955525-44955547 TTCTTCCCTTTGGTGCTCCCAGG - Intergenic
1069321795 10:67180964-67180986 TACTTCCTCATGGTGCTGTCAGG - Intronic
1069772509 10:70908521-70908543 GACGTCAGCTTGGAGCTGCCTGG + Intergenic
1071385099 10:85111981-85112003 GGCTTCCCCGTGGTTCTTCCAGG + Intergenic
1073332290 10:102678226-102678248 CCCTTCCCCCTGCTGCTGCCAGG - Intronic
1076028845 10:127140968-127140990 AGCTTCCCCTTCCTGCTGCCCGG + Intronic
1076730597 10:132437041-132437063 GACTTCCCCTGGGGCCTGGCGGG - Intergenic
1076808064 10:132869214-132869236 GTCTCGCCCTTGGTGCGGCCAGG - Intronic
1078340882 11:10497265-10497287 GGCTGCTGCTTGGTGCTGCCGGG - Intronic
1078729978 11:13964744-13964766 GACTGCCACTCGGTGCAGCCGGG + Intronic
1081958016 11:47110631-47110653 GATTTCCACTGGGTGGTGCCTGG + Intronic
1084600392 11:70142042-70142064 GACTTCAGCTTGCTGCTGTCTGG + Intronic
1085293213 11:75414984-75415006 GACCTCCCCTTGGTGGTGTGAGG - Intronic
1089620967 11:119721930-119721952 CACTTCCCCAGGGAGCTGCCAGG + Intronic
1090029693 11:123195999-123196021 CCCTTCCCCTGGGTGCTGGCTGG - Intergenic
1090637007 11:128695375-128695397 GACTCCCGCTTGGTGTTGCGCGG - Intronic
1090915050 11:131155775-131155797 GAATTCCCCTAGGTGCTGAGGGG - Intergenic
1092185997 12:6478672-6478694 CACTTCCCCCTGCCGCTGCCTGG - Intergenic
1092940614 12:13403988-13404010 GAGTTCCCTTTGGGGCTGCTGGG - Intergenic
1093865904 12:24227218-24227240 GACACCCTCTTGGTGCTGGCAGG - Intergenic
1095313413 12:40728386-40728408 CCCTTCCCCTTGTTCCTGCCTGG - Intronic
1095837942 12:46658849-46658871 GATTTCTCCTGGGTCCTGCCAGG - Intergenic
1097970974 12:65632720-65632742 GACTTCCCCTTGTTCCTCCTTGG + Intergenic
1101708316 12:107241540-107241562 TTCTTCTCCTTGGTACTGCCGGG + Intergenic
1101907132 12:108835513-108835535 GCCTTCCCCTTCCTGCTTCCCGG - Intronic
1102344855 12:112153084-112153106 CACTGCCCCTTGGTGCTGTGTGG + Exonic
1104211277 12:126691194-126691216 CACTGCCCCTAGGTGCTGACAGG - Intergenic
1104578209 12:129988009-129988031 AACTTCCCCTGGCTGGTGCCAGG - Intergenic
1106182369 13:27380643-27380665 TACTTCCCCTTGTTTCAGCCTGG - Intergenic
1107109024 13:36675384-36675406 GCCTTCTCCTAGGTGCTTCCAGG + Intronic
1112368304 13:98773999-98774021 CACTTCCCCTGGGAGCTGCGGGG - Intergenic
1113058450 13:106295667-106295689 GTCTTCACCTTGATGGTGCCGGG - Intergenic
1113664438 13:112131578-112131600 GACTTGCCCTTGCTTCAGCCTGG + Intergenic
1113724532 13:112588236-112588258 GCATTCCCCCTGCTGCTGCCCGG + Intergenic
1118457722 14:65959930-65959952 GACCTTCCCTTAGTGTTGCCAGG + Intronic
1118978732 14:70699239-70699261 GACCTCCTCCTGGTGCTCCCTGG - Intergenic
1119281170 14:73409360-73409382 GACTTCTCCTTGTGGCTGCTTGG - Intronic
1119348494 14:73945049-73945071 GACTTTCCATTAGGGCTGCCAGG - Intronic
1119821063 14:77616583-77616605 GCCTTGCGCCTGGTGCTGCCAGG - Exonic
1120160303 14:81138482-81138504 GAATTACCCTTGGTGCTGCTGGG - Intronic
1120384549 14:83827690-83827712 GAAATCCCCTTGGTGCTAGCTGG - Intergenic
1120564080 14:86032835-86032857 GCCATCCCCTTGGTGATGACTGG - Intergenic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1121530749 14:94651599-94651621 GAGGTCCCCTTGCAGCTGCCAGG + Intergenic
1122548374 14:102537422-102537444 GCCCTCCCCTTGGGGCTGCAAGG + Intergenic
1122548633 14:102538526-102538548 GCCCTCCCCTTGGGGCTGCAAGG - Intergenic
1122776284 14:104118297-104118319 GTCTTCTGCCTGGTGCTGCCTGG + Intergenic
1125513245 15:40303916-40303938 GCCTCCACCTTGGTGCAGCCAGG + Intronic
1128155002 15:65386445-65386467 GACTTGCCCTTGGCACTCCCAGG - Intronic
1128509993 15:68307503-68307525 GTCTTCCACCTGGGGCTGCCTGG - Intronic
1129737914 15:77976092-77976114 GACTTCCCCTTGGTGCTGCCTGG + Intergenic
1129848164 15:78777517-78777539 GACTTCCCCTCGGTGCCACCTGG - Exonic
1130109174 15:80950553-80950575 AACTCCCCATTGGTGCTACCTGG + Exonic
1130253757 15:82316419-82316441 GACTTCCCATCAGTGCTGCCTGG + Intergenic
1132120370 15:99170485-99170507 GATTCCCCCTTGGTGCTGGGTGG + Intronic
1134070938 16:11259317-11259339 GACTTCCCCCAGATGCTGGCTGG - Intronic
1135866629 16:26108928-26108950 GAATTCCTCTTAGTGCTTCCAGG - Intronic
1139371139 16:66470135-66470157 GACCAGCCCTTGGTGCAGCCTGG - Intronic
1141204106 16:81920075-81920097 GACTTCCTCTTGGTGCCTCCAGG - Intronic
1141268428 16:82517854-82517876 GCCTTCCCCTTGCTCCTGTCTGG - Intergenic
1141756886 16:85997190-85997212 GACTTCACCCTGCTGCTGCTGGG + Intergenic
1142263159 16:89051832-89051854 GACTTTGCCTTGGAGCTGCTGGG + Intergenic
1146932669 17:36788729-36788751 GGCTTCCCCTTCGTGATTCCAGG - Intergenic
1148888269 17:50789194-50789216 GACTGGTCCTTGGGGCTGCCTGG - Intergenic
1149547776 17:57517256-57517278 TCCTTCCCCTTTGGGCTGCCTGG - Intronic
1151474596 17:74338521-74338543 GACTTCCACATGAGGCTGCCAGG + Intronic
1152271119 17:79325412-79325434 GATTTCCCCACAGTGCTGCCGGG - Intronic
1152391937 17:80008568-80008590 GAGCTCCCCCTGGTGGTGCCAGG - Intronic
1155400426 18:25432897-25432919 CACTTCTCCTTGCTGCTGCCAGG + Intergenic
1157564438 18:48670414-48670436 GAGTTCCCCTTGCTCCTTCCAGG - Intronic
1157769506 18:50333529-50333551 TGCTTTCCCTTGGTCCTGCCAGG + Intergenic
1157906884 18:51577178-51577200 GACTCCCCATTCATGCTGCCAGG + Intergenic
1159793715 18:72816601-72816623 AAATTCTCCTTGCTGCTGCCTGG - Intronic
1160295446 18:77632933-77632955 CACTTCCCCTTTGTGCTGCTTGG + Intergenic
1161566419 19:5005313-5005335 TCCTTCCCAGTGGTGCTGCCAGG + Intronic
1161625525 19:5324392-5324414 GTCTTCTCCTGGGTCCTGCCAGG - Intronic
1163697676 19:18772205-18772227 GAATGCCCCTTCGTTCTGCCTGG + Intronic
1165778151 19:38417044-38417066 GGATTCACCTTGGTGCTGTCAGG + Exonic
1166213503 19:41321748-41321770 TTCTGCCCCTTGGTGCTGCTGGG - Intronic
1166284053 19:41812699-41812721 GACTTTTCCCTGGAGCTGCCAGG - Intergenic
1167794059 19:51697697-51697719 GACTGCCTCTTGGTGATCCCAGG + Intergenic
925743764 2:7028106-7028128 GACTCCTCCTTGGGGCCGCCAGG - Intronic
926795863 2:16618345-16618367 CACTCCCCCTGGGTGCAGCCAGG + Intronic
928800360 2:35082355-35082377 CACTCCACCTTGTTGCTGCCAGG - Intergenic
929373967 2:41261420-41261442 CACTTCCCCTTGGTGTTGGTTGG + Intergenic
931101484 2:59006507-59006529 GACCCTCCCTTGGTCCTGCCAGG - Intergenic
931460293 2:62444199-62444221 GACTTCACCTGGGATCTGCCAGG + Intergenic
934757072 2:96831880-96831902 GCCCTCTCCATGGTGCTGCCCGG + Intronic
935781983 2:106516226-106516248 GATGTCCCCCTGGTGCTGCTGGG - Intergenic
937974006 2:127570075-127570097 TCTTTCCCCTTTGTGCTGCCTGG - Intronic
947987787 2:234463701-234463723 GACTTCCCCTTGCTCCTGGAAGG + Intergenic
947995384 2:234523065-234523087 GACTTCCTCCTGCTCCTGCCAGG + Intergenic
948363695 2:237440683-237440705 GTCTTCCCCTCCATGCTGCCTGG + Intergenic
1170635287 20:18099119-18099141 GCCTCACCCTTGGTGTTGCCTGG + Intergenic
1171406893 20:24917806-24917828 GACTTCCACTTGCTGCTCCAGGG + Intergenic
1172163813 20:32886583-32886605 GACTCCCCCTTGGTGCACCAAGG - Intronic
1173499087 20:43539405-43539427 GCCTCCCCCTTGGTGGGGCCTGG - Intronic
1175335360 20:58192685-58192707 AACTTCCCCGTGATGCTGTCAGG - Intergenic
1176001294 20:62832491-62832513 GAGTTCCCATTGGTGCCTCCTGG - Intronic
1178875906 21:36413707-36413729 CTCTTCCTCTTGGTGATGCCAGG + Intronic
1181391692 22:22587877-22587899 GACTTCTCCTTTGTGCTGTGAGG - Intergenic
1181961480 22:26625022-26625044 GAATTCCCCGTGATCCTGCCAGG - Intronic
1183036132 22:35142283-35142305 AACTTCCCCTTGGTACTCTCTGG + Intergenic
1183194981 22:36347299-36347321 CACTTCCCCTTGGTCAAGCCTGG + Intronic
1184956740 22:47892468-47892490 GCCCTCCACTTGGTGCTGACAGG + Intergenic
949307671 3:2661262-2661284 CACTCCTCCTTGGGGCTGCCTGG - Intronic
950210604 3:11120352-11120374 GACTTCCTTTGGGTGCTGGCAGG - Intergenic
950768533 3:15292327-15292349 GAGCCCCCCTTGGTGCTGCTGGG - Intronic
951040444 3:17983372-17983394 GATTTCCTCTTGGCTCTGCCTGG + Intronic
952221055 3:31324840-31324862 GACTGCCCCTGGGTGCTGAGTGG + Intergenic
953025540 3:39142830-39142852 GGCTTCCCCTTTCAGCTGCCCGG - Exonic
958982580 3:100740377-100740399 GACTTCTCCATGGGGCTGCTTGG + Intronic
960086285 3:113594957-113594979 TCCTTCCCTCTGGTGCTGCCAGG - Intronic
960157272 3:114308785-114308807 AACATCCCCTTGGTGCTCCCAGG - Exonic
960294356 3:115925055-115925077 GTCTGCTCCTTGGTTCTGCCTGG + Intronic
960526940 3:118720986-118721008 GATTTCACCTTGTTACTGCCAGG + Intergenic
962198404 3:133381946-133381968 AGCTTCTCCTTGCTGCTGCCTGG + Intronic
963294080 3:143526226-143526248 GACTTCCTTTTGGTGCTTCTAGG - Intronic
963711730 3:148754754-148754776 GAGTTCCCCTTGATGCTCCCAGG + Intergenic
967316549 3:188155692-188155714 AACTGCCCCCTGGTGCTGGCAGG - Intronic
969114459 4:4862382-4862404 GAAATCACCTTTGTGCTGCCCGG - Intronic
969425086 4:7119663-7119685 GACTTCCTCTCGGTGCTGAAGGG - Intergenic
969536631 4:7760374-7760396 GACCTTCCCTTGGGGCTGGCGGG - Exonic
969573857 4:8025311-8025333 GACCTCCCCTGGGTGGGGCCAGG - Intronic
973010621 4:45068617-45068639 GACTTCCCCTTGCTGCTCTGAGG + Intergenic
973268251 4:48232806-48232828 GCCTTCCCCTTGGTGGGACCTGG - Intronic
973993643 4:56435753-56435775 GCCTTCCCCTAAGAGCTGCCTGG + Intronic
976969451 4:91087248-91087270 GGCTTCTCCTTGCTGCTTCCTGG + Intronic
978385404 4:108172194-108172216 GTCTTCCCCTTTGTGTGGCCTGG + Intergenic
980930481 4:139178172-139178194 GGCGGCCCCTTGGAGCTGCCCGG + Intergenic
983664884 4:170169963-170169985 GACTTACCCTTTCTGCAGCCTGG + Intergenic
985729055 5:1536501-1536523 GGTTTCCCTTTGGTGCTGTCTGG + Intergenic
987090993 5:14507569-14507591 GCATTCCCCTTGGTGCTGGGAGG + Intronic
988919420 5:35926625-35926647 GACTTGTCTTTGGTGCTCCCTGG + Intronic
990404790 5:55478335-55478357 GAATTCCGCTAGGTGCTACCAGG + Intronic
991060456 5:62369358-62369380 CACTTCTCCTTCCTGCTGCCTGG - Intronic
992895305 5:81240207-81240229 TGCTTCCCCTCAGTGCTGCCTGG + Intronic
997431114 5:133841908-133841930 TGCTTCCCCGTGGTGCTGCTTGG - Intergenic
1000609754 5:163360838-163360860 CACTTCTCCTTGCTGCTGCTTGG + Intergenic
1000765633 5:165285922-165285944 TCCTTTCCCTTGGAGCTGCCTGG + Intergenic
1003881535 6:10483712-10483734 GACTGCCCCACGGAGCTGCCAGG - Intergenic
1007381841 6:41495215-41495237 GGCTTCCCCTTGGAACTGGCTGG - Intergenic
1018210940 6:161481013-161481035 CACTTCCACGTGCTGCTGCCTGG - Intronic
1019199449 6:170302221-170302243 CATTTCTCCTTGCTGCTGCCAGG - Intronic
1020624296 7:10558570-10558592 GAATTCCCCTAGGTCCTGCTTGG - Intergenic
1023758758 7:43444607-43444629 GGCTCCTCCTTGGTGCTGGCTGG - Exonic
1024405589 7:48975915-48975937 GAGCTCCCCTTGGTGCTTCCTGG + Intergenic
1024508634 7:50184949-50184971 GCCTTGCCCCTGGTGCAGCCGGG + Intergenic
1024535082 7:50423822-50423844 GCCTTCCCCATGGTTTTGCCTGG + Intergenic
1026874614 7:73872065-73872087 GGCTTCTCCTGGGTGCTGCCTGG + Intergenic
1027187725 7:75981934-75981956 GATGGCCCCTGGGTGCTGCCCGG + Intronic
1027312852 7:76966026-76966048 GACCTGCCCTGGGCGCTGCCAGG + Intergenic
1029409703 7:100401021-100401043 GACTTCCCCGTGGCGCTGTTTGG - Exonic
1033365591 7:140670912-140670934 GACTTCCCTTTGGTTCTTCGAGG + Intronic
1034010248 7:147521833-147521855 GTTTTCCCCTTTGTGCTCCCAGG + Intronic
1038193003 8:25340994-25341016 GAGTTACCCATGATGCTGCCAGG - Intronic
1041271405 8:56113035-56113057 GACGTCCCCAAGGCGCTGCCCGG + Exonic
1044523822 8:93229668-93229690 CGCGTCCCCTTGGTGCTGGCTGG - Intergenic
1048206632 8:132420580-132420602 GACCTCCCTTATGTGCTGCCTGG - Intronic
1048885929 8:138909804-138909826 GACTTCCCTTTGCTTGTGCCAGG + Intronic
1053478075 9:38396304-38396326 AACTTCCCCTTGGTCATGCAGGG + Exonic
1059424050 9:114209793-114209815 GACTTCCCCAGGCTGGTGCCTGG - Intronic
1061543299 9:131289807-131289829 GACGTCCCCTTGGAGCTGGGTGG + Exonic
1185757845 X:2666224-2666246 AACATCCCCTTGGTGCTTACTGG - Intergenic
1187476026 X:19611721-19611743 TATTTCCCCTTGGTGATGACTGG + Intronic
1191820433 X:65300343-65300365 GACTTGCCTTTTGTGCTGCGTGG + Intergenic
1195157536 X:102139458-102139480 GATATCACCTTGGTGCTGCTTGG - Intergenic
1197059062 X:122154818-122154840 CACTGCTCCTTGCTGCTGCCTGG + Intergenic
1197582708 X:128304233-128304255 CACTTCTCCTTCCTGCTGCCTGG + Intergenic
1197822215 X:130552855-130552877 GACCTCCCTTTGGAACTGCCAGG - Intergenic
1198040176 X:132843011-132843033 GACTGCCACTCGGGGCTGCCTGG - Intronic
1200132560 X:153859055-153859077 GACTTCCCTTTGGTGCGACAAGG + Intergenic