ID: 1129737914

View in Genome Browser
Species Human (GRCh38)
Location 15:77976092-77976114
Sequence GACTTCCCCTTGGTGCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 176}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129737909_1129737914 -1 Left 1129737909 15:77976070-77976092 CCCTCCTGCCAAGGACATCATCG 0: 1
1: 1
2: 1
3: 9
4: 97
Right 1129737914 15:77976092-77976114 GACTTCCCCTTGGTGCTGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 176
1129737911_1129737914 -5 Left 1129737911 15:77976074-77976096 CCTGCCAAGGACATCATCGACTT 0: 1
1: 2
2: 2
3: 12
4: 308
Right 1129737914 15:77976092-77976114 GACTTCCCCTTGGTGCTGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 176
1129737904_1129737914 26 Left 1129737904 15:77976043-77976065 CCATGGATGGGGCCTGTGCCTGG 0: 1
1: 1
2: 5
3: 34
4: 387
Right 1129737914 15:77976092-77976114 GACTTCCCCTTGGTGCTGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 176
1129737912_1129737914 -9 Left 1129737912 15:77976078-77976100 CCAAGGACATCATCGACTTCCCC 0: 1
1: 1
2: 1
3: 5
4: 110
Right 1129737914 15:77976092-77976114 GACTTCCCCTTGGTGCTGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 176
1129737910_1129737914 -2 Left 1129737910 15:77976071-77976093 CCTCCTGCCAAGGACATCATCGA 0: 1
1: 2
2: 1
3: 6
4: 101
Right 1129737914 15:77976092-77976114 GACTTCCCCTTGGTGCTGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 176
1129737906_1129737914 14 Left 1129737906 15:77976055-77976077 CCTGTGCCTGGACGACCCTCCTG No data
Right 1129737914 15:77976092-77976114 GACTTCCCCTTGGTGCTGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 176
1129737907_1129737914 8 Left 1129737907 15:77976061-77976083 CCTGGACGACCCTCCTGCCAAGG No data
Right 1129737914 15:77976092-77976114 GACTTCCCCTTGGTGCTGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129737914 Original CRISPR GACTTCCCCTTGGTGCTGCC TGG Intergenic