ID: 1129738792

View in Genome Browser
Species Human (GRCh38)
Location 15:77979932-77979954
Sequence CTCTGTGGCCCCAGCCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129738792_1129738801 -2 Left 1129738792 15:77979932-77979954 CCCCCGGGGCTGGGGCCACAGAG No data
Right 1129738801 15:77979953-77979975 AGGGCTGGCCGCCAGCACCAGGG No data
1129738792_1129738800 -3 Left 1129738792 15:77979932-77979954 CCCCCGGGGCTGGGGCCACAGAG No data
Right 1129738800 15:77979952-77979974 GAGGGCTGGCCGCCAGCACCAGG No data
1129738792_1129738810 29 Left 1129738792 15:77979932-77979954 CCCCCGGGGCTGGGGCCACAGAG No data
Right 1129738810 15:77979984-77980006 TCCTCGTGTGTTGCAGAACGTGG No data
1129738792_1129738812 30 Left 1129738792 15:77979932-77979954 CCCCCGGGGCTGGGGCCACAGAG No data
Right 1129738812 15:77979985-77980007 CCTCGTGTGTTGCAGAACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129738792 Original CRISPR CTCTGTGGCCCCAGCCCCGG GGG (reversed) Intergenic