ID: 1129738799

View in Genome Browser
Species Human (GRCh38)
Location 15:77979947-77979969
Sequence TGCTGGCGGCCAGCCCTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129738799_1129738812 15 Left 1129738799 15:77979947-77979969 CCACAGAGGGCTGGCCGCCAGCA No data
Right 1129738812 15:77979985-77980007 CCTCGTGTGTTGCAGAACGTGGG No data
1129738799_1129738810 14 Left 1129738799 15:77979947-77979969 CCACAGAGGGCTGGCCGCCAGCA No data
Right 1129738810 15:77979984-77980006 TCCTCGTGTGTTGCAGAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129738799 Original CRISPR TGCTGGCGGCCAGCCCTCTG TGG (reversed) Intergenic