ID: 1129738801

View in Genome Browser
Species Human (GRCh38)
Location 15:77979953-77979975
Sequence AGGGCTGGCCGCCAGCACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129738795_1129738801 -4 Left 1129738795 15:77979934-77979956 CCCGGGGCTGGGGCCACAGAGGG No data
Right 1129738801 15:77979953-77979975 AGGGCTGGCCGCCAGCACCAGGG No data
1129738784_1129738801 13 Left 1129738784 15:77979917-77979939 CCTGACCCTGGCTGGCCCCCGGG No data
Right 1129738801 15:77979953-77979975 AGGGCTGGCCGCCAGCACCAGGG No data
1129738779_1129738801 26 Left 1129738779 15:77979904-77979926 CCAGCTTTCTCCTCCTGACCCTG 0: 1
1: 2
2: 6
3: 76
4: 601
Right 1129738801 15:77979953-77979975 AGGGCTGGCCGCCAGCACCAGGG No data
1129738789_1129738801 7 Left 1129738789 15:77979923-77979945 CCTGGCTGGCCCCCGGGGCTGGG No data
Right 1129738801 15:77979953-77979975 AGGGCTGGCCGCCAGCACCAGGG No data
1129738787_1129738801 8 Left 1129738787 15:77979922-77979944 CCCTGGCTGGCCCCCGGGGCTGG No data
Right 1129738801 15:77979953-77979975 AGGGCTGGCCGCCAGCACCAGGG No data
1129738782_1129738801 16 Left 1129738782 15:77979914-77979936 CCTCCTGACCCTGGCTGGCCCCC 0: 1
1: 0
2: 4
3: 79
4: 522
Right 1129738801 15:77979953-77979975 AGGGCTGGCCGCCAGCACCAGGG No data
1129738793_1129738801 -3 Left 1129738793 15:77979933-77979955 CCCCGGGGCTGGGGCCACAGAGG No data
Right 1129738801 15:77979953-77979975 AGGGCTGGCCGCCAGCACCAGGG No data
1129738778_1129738801 27 Left 1129738778 15:77979903-77979925 CCCAGCTTTCTCCTCCTGACCCT 0: 1
1: 2
2: 6
3: 52
4: 478
Right 1129738801 15:77979953-77979975 AGGGCTGGCCGCCAGCACCAGGG No data
1129738792_1129738801 -2 Left 1129738792 15:77979932-77979954 CCCCCGGGGCTGGGGCCACAGAG No data
Right 1129738801 15:77979953-77979975 AGGGCTGGCCGCCAGCACCAGGG No data
1129738797_1129738801 -5 Left 1129738797 15:77979935-77979957 CCGGGGCTGGGGCCACAGAGGGC No data
Right 1129738801 15:77979953-77979975 AGGGCTGGCCGCCAGCACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129738801 Original CRISPR AGGGCTGGCCGCCAGCACCA GGG Intergenic
No off target data available for this crispr