ID: 1129738802

View in Genome Browser
Species Human (GRCh38)
Location 15:77979961-77979983
Sequence GGGGAGGGCCCTGGTGCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1031
Summary {0: 1, 1: 3, 2: 4, 3: 104, 4: 919}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129738802_1129738812 1 Left 1129738802 15:77979961-77979983 CCGCCAGCACCAGGGCCCTCCCC 0: 1
1: 3
2: 4
3: 104
4: 919
Right 1129738812 15:77979985-77980007 CCTCGTGTGTTGCAGAACGTGGG No data
1129738802_1129738810 0 Left 1129738802 15:77979961-77979983 CCGCCAGCACCAGGGCCCTCCCC 0: 1
1: 3
2: 4
3: 104
4: 919
Right 1129738810 15:77979984-77980006 TCCTCGTGTGTTGCAGAACGTGG No data
1129738802_1129738813 25 Left 1129738802 15:77979961-77979983 CCGCCAGCACCAGGGCCCTCCCC 0: 1
1: 3
2: 4
3: 104
4: 919
Right 1129738813 15:77980009-77980031 TGTGACTTCGAGATTGACTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129738802 Original CRISPR GGGGAGGGCCCTGGTGCTGG CGG (reversed) Intergenic