ID: 1129738804

View in Genome Browser
Species Human (GRCh38)
Location 15:77979970-77979992
Sequence ACACGAGGAGGGGAGGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 2, 2: 5, 3: 20, 4: 348}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129738804_1129738812 -8 Left 1129738804 15:77979970-77979992 CCAGGGCCCTCCCCTCCTCGTGT 0: 1
1: 2
2: 5
3: 20
4: 348
Right 1129738812 15:77979985-77980007 CCTCGTGTGTTGCAGAACGTGGG No data
1129738804_1129738813 16 Left 1129738804 15:77979970-77979992 CCAGGGCCCTCCCCTCCTCGTGT 0: 1
1: 2
2: 5
3: 20
4: 348
Right 1129738813 15:77980009-77980031 TGTGACTTCGAGATTGACTCCGG No data
1129738804_1129738814 24 Left 1129738804 15:77979970-77979992 CCAGGGCCCTCCCCTCCTCGTGT 0: 1
1: 2
2: 5
3: 20
4: 348
Right 1129738814 15:77980017-77980039 CGAGATTGACTCCGGTGCTATGG No data
1129738804_1129738815 27 Left 1129738804 15:77979970-77979992 CCAGGGCCCTCCCCTCCTCGTGT 0: 1
1: 2
2: 5
3: 20
4: 348
Right 1129738815 15:77980020-77980042 GATTGACTCCGGTGCTATGGAGG No data
1129738804_1129738810 -9 Left 1129738804 15:77979970-77979992 CCAGGGCCCTCCCCTCCTCGTGT 0: 1
1: 2
2: 5
3: 20
4: 348
Right 1129738810 15:77979984-77980006 TCCTCGTGTGTTGCAGAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129738804 Original CRISPR ACACGAGGAGGGGAGGGCCC TGG (reversed) Intergenic