ID: 1129738812

View in Genome Browser
Species Human (GRCh38)
Location 15:77979985-77980007
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129738797_1129738812 27 Left 1129738797 15:77979935-77979957 CCGGGGCTGGGGCCACAGAGGGC No data
Right 1129738812 15:77979985-77980007 CCTCGTGTGTTGCAGAACGTGGG No data
1129738804_1129738812 -8 Left 1129738804 15:77979970-77979992 CCAGGGCCCTCCCCTCCTCGTGT 0: 1
1: 2
2: 5
3: 20
4: 348
Right 1129738812 15:77979985-77980007 CCTCGTGTGTTGCAGAACGTGGG No data
1129738803_1129738812 -2 Left 1129738803 15:77979964-77979986 CCAGCACCAGGGCCCTCCCCTCC 0: 1
1: 4
2: 12
3: 72
4: 848
Right 1129738812 15:77979985-77980007 CCTCGTGTGTTGCAGAACGTGGG No data
1129738793_1129738812 29 Left 1129738793 15:77979933-77979955 CCCCGGGGCTGGGGCCACAGAGG No data
Right 1129738812 15:77979985-77980007 CCTCGTGTGTTGCAGAACGTGGG No data
1129738795_1129738812 28 Left 1129738795 15:77979934-77979956 CCCGGGGCTGGGGCCACAGAGGG No data
Right 1129738812 15:77979985-77980007 CCTCGTGTGTTGCAGAACGTGGG No data
1129738802_1129738812 1 Left 1129738802 15:77979961-77979983 CCGCCAGCACCAGGGCCCTCCCC 0: 1
1: 3
2: 4
3: 104
4: 919
Right 1129738812 15:77979985-77980007 CCTCGTGTGTTGCAGAACGTGGG No data
1129738792_1129738812 30 Left 1129738792 15:77979932-77979954 CCCCCGGGGCTGGGGCCACAGAG No data
Right 1129738812 15:77979985-77980007 CCTCGTGTGTTGCAGAACGTGGG No data
1129738799_1129738812 15 Left 1129738799 15:77979947-77979969 CCACAGAGGGCTGGCCGCCAGCA No data
Right 1129738812 15:77979985-77980007 CCTCGTGTGTTGCAGAACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129738812 Original CRISPR CCTCGTGTGTTGCAGAACGT GGG Intergenic
No off target data available for this crispr