ID: 1129739880

View in Genome Browser
Species Human (GRCh38)
Location 15:77985080-77985102
Sequence GCCACCCATGTGCCCCCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 170}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129739876_1129739880 1 Left 1129739876 15:77985056-77985078 CCACCCGTCTGATGCCATGCTGA 0: 1
1: 0
2: 2
3: 9
4: 79
Right 1129739880 15:77985080-77985102 GCCACCCATGTGCCCCCGCCAGG 0: 1
1: 0
2: 0
3: 24
4: 170
1129739875_1129739880 11 Left 1129739875 15:77985046-77985068 CCTGCTGATGCCACCCGTCTGAT 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1129739880 15:77985080-77985102 GCCACCCATGTGCCCCCGCCAGG 0: 1
1: 0
2: 0
3: 24
4: 170
1129739878_1129739880 -3 Left 1129739878 15:77985060-77985082 CCGTCTGATGCCATGCTGATGCC 0: 1
1: 0
2: 5
3: 27
4: 424
Right 1129739880 15:77985080-77985102 GCCACCCATGTGCCCCCGCCAGG 0: 1
1: 0
2: 0
3: 24
4: 170
1129739877_1129739880 -2 Left 1129739877 15:77985059-77985081 CCCGTCTGATGCCATGCTGATGC 0: 1
1: 0
2: 3
3: 10
4: 110
Right 1129739880 15:77985080-77985102 GCCACCCATGTGCCCCCGCCAGG 0: 1
1: 0
2: 0
3: 24
4: 170
1129739874_1129739880 23 Left 1129739874 15:77985034-77985056 CCTGCTGAAGAGCCTGCTGATGC 0: 1
1: 1
2: 0
3: 17
4: 211
Right 1129739880 15:77985080-77985102 GCCACCCATGTGCCCCCGCCAGG 0: 1
1: 0
2: 0
3: 24
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129739880 Original CRISPR GCCACCCATGTGCCCCCGCC AGG Intronic
900111075 1:1005887-1005909 GCCACGCATGCCCCTCCGCCTGG - Intergenic
900148054 1:1166916-1166938 GCCCCCCAGGTGCCCACCCCAGG + Intergenic
900488612 1:2935343-2935365 GCCACCCATGTGGTCCAGCAGGG - Intergenic
900822480 1:4900010-4900032 GCCACCCATGCCCCACAGCCAGG - Intergenic
901841751 1:11958088-11958110 GCCACCCAAGTGCCTCCTCCTGG + Intronic
902113486 1:14102414-14102436 TCCACCCATGTGACCCCTCCTGG + Intergenic
908195371 1:61742395-61742417 GCCACCCCGGTGCCCCGCCCCGG + Intergenic
910513852 1:88036682-88036704 GCCACCCAAGAGCCCCCACAAGG - Intergenic
913222147 1:116667881-116667903 GCCACCCTCATGCCCCCGCCAGG - Intergenic
915078954 1:153338166-153338188 CCCACCCATTGGCCCCAGCCAGG + Intronic
915458188 1:156053980-156054002 GCCCCCCAGGGGCCCCCGCCTGG - Intergenic
916313547 1:163423167-163423189 CGCTCCCATGTGCCCCTGCCGGG - Intergenic
1063177623 10:3566482-3566504 GGCACCCCTGTGCTCCAGCCTGG - Intergenic
1064989305 10:21242159-21242181 GCCACCACTGTGCTCCAGCCTGG + Intergenic
1070365369 10:75731777-75731799 GCCACCCATGTGCCAGGCCCTGG - Intronic
1070686842 10:78491265-78491287 GCCTCCCATGTATCCCAGCCAGG + Intergenic
1071875234 10:89837331-89837353 GCCACCCAGGTCACCACGCCTGG - Intergenic
1075852893 10:125603322-125603344 CCCACCCCTGGACCCCCGCCAGG - Intronic
1076070242 10:127483021-127483043 ACCACCCAGTTGCCCCAGCCAGG + Intergenic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1077284980 11:1761644-1761666 GCAACCCATTGCCCCCCGCCAGG + Intronic
1077369494 11:2174793-2174815 GCCAGCCGTGTGCTCCCTCCAGG - Intergenic
1078088091 11:8246830-8246852 GCCTCCCAGGTCCCCCCACCTGG - Intronic
1081860846 11:46332741-46332763 ACCACCTCTGCGCCCCCGCCCGG - Intergenic
1083316251 11:61816522-61816544 CCCTCTCCTGTGCCCCCGCCTGG + Intronic
1084438169 11:69156057-69156079 GCCACCCTGGAGCCCCTGCCTGG - Intergenic
1085468596 11:76741487-76741509 GCCAGCCCTGTGCCCCTGCCTGG + Intergenic
1085532754 11:77201647-77201669 CCCACCCATCTGCCACCCCCAGG - Intronic
1087396137 11:97601885-97601907 GCCACTCATCTGCACCCACCTGG + Intergenic
1088169364 11:106978232-106978254 GCCACCCTTCTGCCCCAACCAGG + Intronic
1090269741 11:125377868-125377890 GCCACCCATGGGCCGCGGGCTGG + Intronic
1097263213 12:57731202-57731224 GCCCACCATGTGCCCATGCCAGG - Intronic
1103303015 12:119942556-119942578 GCCACCCACATGCCCCCTCAAGG + Intergenic
1105013687 12:132773178-132773200 GCCAGCCCTGTGCCCCCGGGGGG - Exonic
1105033949 12:132904822-132904844 GCCACCCAGGAGCCCCGGCTTGG - Intronic
1106409329 13:29500051-29500073 GCCACCCATCTTCCCCCTCCTGG + Intronic
1107943185 13:45392922-45392944 GCCAACCAGGTGTCCCTGCCTGG + Intergenic
1112260048 13:97869504-97869526 CCCATCCATTTGCCCCTGCCTGG - Intergenic
1113885544 13:113656810-113656832 GACTCCCATGTGCCGCCTCCTGG - Intronic
1121774744 14:96583219-96583241 GCCCTCCATCTGCCCCTGCCAGG + Intergenic
1122412069 14:101530716-101530738 GCCACCCATGTGCCCATCCTGGG + Intergenic
1122664501 14:103319248-103319270 GCCACCCACCTGCCCCCTCCCGG + Intergenic
1122889569 14:104726072-104726094 GCCACCAGGCTGCCCCCGCCAGG + Intronic
1126026182 15:44448218-44448240 GGCACCCATGTGCTCCAGGCCGG + Intronic
1128654469 15:69450394-69450416 GGCACCACTGTGCCCCAGCCTGG + Intergenic
1129232827 15:74206200-74206222 GCCTCCCACCTGCCCCCTCCTGG + Intronic
1129413509 15:75362347-75362369 TCCACCCAGGTGCCCCCCACAGG + Exonic
1129739880 15:77985080-77985102 GCCACCCATGTGCCCCCGCCAGG + Intronic
1129845899 15:78767592-78767614 GCCACCTGTGTGCCCTCGCCAGG - Exonic
1131593470 15:93773356-93773378 GCCACCCCTGTGCTCCTCCCAGG + Intergenic
1132480902 16:165694-165716 TCCTCCCATGTGCTCCCTCCTGG + Intronic
1132678726 16:1131084-1131106 GCTACCCTTGTGCCCGCCCCTGG + Intergenic
1134040449 16:11064354-11064376 CTCACCCATGTGCTGCCGCCCGG + Intronic
1136040354 16:27573968-27573990 GCCTCCCATCAGCCCTCGCCAGG - Intronic
1136682609 16:31976769-31976791 CCCACCCAGGGGCCCCCGTCTGG + Intergenic
1136782870 16:32917937-32917959 CCCACCCAGGGGCCCCCGTCTGG + Intergenic
1137686558 16:50390740-50390762 GCCATCCCAGGGCCCCCGCCAGG + Intergenic
1138514725 16:57529634-57529656 ACCAGCCCAGTGCCCCCGCCTGG - Intronic
1139546707 16:67653117-67653139 GCCGCCCCTGGGCCCCCGGCCGG + Exonic
1139608452 16:68037459-68037481 GGCACCATTGTACCCCCGCCTGG - Intronic
1141707609 16:85676530-85676552 GCTGCCCACGTGTCCCCGCCAGG - Exonic
1141723260 16:85768651-85768673 GCTACCTATGTGCCCAGGCCAGG + Intergenic
1141812045 16:86382446-86382468 GCCACTCAGGAGCCCCCGGCGGG - Intergenic
1142210804 16:88807652-88807674 GCCACCCCTGAGCCTCCGCCCGG + Intronic
1203085518 16_KI270728v1_random:1181921-1181943 CCCACCCAGGGGCCCCCGTCTGG + Intergenic
1142814259 17:2412868-2412890 GCCAGCCAAGTGCCCCAGCTGGG + Intronic
1143093772 17:4465682-4465704 GCCACCAATGTGCTCCAGCCTGG + Intronic
1145311038 17:21701191-21701213 GCCACTGATGTGCCCACCCCCGG - Intronic
1145903656 17:28504960-28504982 ACCACCACTGTGCCCCGGCCAGG + Intronic
1146439057 17:32877326-32877348 GCCACCCAGCTGCCGCCGCCCGG - Intergenic
1148819868 17:50354151-50354173 GCCACCCCCCTGCCCCCGCCTGG - Intronic
1152466065 17:80466751-80466773 GCCACCCCTCTTCCCCAGCCAGG - Intergenic
1156055613 18:32999047-32999069 GCCATCCAAGTGCCACAGCCTGG - Intronic
1157021877 18:43792888-43792910 GCCACCCATGTGAAACAGCCAGG - Intergenic
1159001438 18:62978757-62978779 GCCTCCGATGAGCCCCCGCCCGG + Exonic
1159040659 18:63320337-63320359 GCGCGCCATGTGCCCCCGGCGGG - Intergenic
1160739869 19:680740-680762 GCCACCCATGTGACCTGTCCTGG - Intronic
1161010529 19:1957584-1957606 GTCCCCCATGTCCCCTCGCCCGG + Intronic
1162181331 19:8871155-8871177 GTCCCCCAAGTGCCCCCACCAGG + Intronic
1163447019 19:17352891-17352913 TCCACCCCTCTGCCCCTGCCAGG + Intronic
1164402688 19:27912461-27912483 GCCACCCTTGTGGGCCCACCTGG + Intergenic
1164645840 19:29858346-29858368 GCCATCCAGCTGCCCCTGCCTGG + Intergenic
1164907843 19:31981994-31982016 ACCACCCATGTGCCAACCCCTGG - Intergenic
1165090978 19:33388332-33388354 GCCACCCATGTGCACACACCCGG + Intronic
1165431527 19:35775939-35775961 GCCACCCAAGTGGCCCCTGCAGG + Intronic
1167296408 19:48652894-48652916 GCCACCACTGTGCTCCAGCCTGG - Intergenic
925185132 2:1842096-1842118 CCCACCCGTGTGCCAGCGCCGGG - Intronic
925260052 2:2521001-2521023 GCCAGCCATGTGCCCCTCACAGG - Intergenic
927351380 2:22120882-22120904 GCCACCAATGTGTTCCAGCCTGG - Intergenic
927600346 2:24435154-24435176 GCCACCCTTGTGGGCCCGGCAGG + Intergenic
927680042 2:25133019-25133041 GCCACCAATCTCCCCCAGCCTGG + Intronic
928838279 2:35574906-35574928 CCCACCCATGTGCACCCTCAGGG - Intergenic
929996170 2:46827633-46827655 GCCACCTCCCTGCCCCCGCCAGG + Intronic
932548013 2:72735738-72735760 GCAACCCACGTCCCCCCACCCGG - Intronic
942514517 2:176737906-176737928 GCCACCCAGGTGCCCCCTTTTGG + Intergenic
942787677 2:179719164-179719186 TCCACCCATGAGCCCACCCCAGG + Intronic
943703638 2:191013007-191013029 CCCACCCACCTTCCCCCGCCGGG - Intronic
944774871 2:202953058-202953080 GCCACCAATGTACTCCAGCCTGG - Intronic
945894394 2:215465988-215466010 CCCATCCATCTGCCCCCTCCAGG + Intergenic
948523422 2:238556610-238556632 GCCACCCAGATGCCCCTTCCAGG + Intergenic
948816256 2:240511822-240511844 GGCAGCCCTGTGCCCCCGCCAGG + Intronic
949041056 2:241850156-241850178 GCCCCCCATGTGCCCACCCTGGG - Exonic
1169082500 20:2805813-2805835 GCTGCCCATCTGCCCCTGCCTGG - Intergenic
1169143460 20:3238554-3238576 GCCAGCCCTGGGTCCCCGCCAGG - Intronic
1171419684 20:25009601-25009623 GCCACACATGTGCACTCACCTGG - Intronic
1172835040 20:37868017-37868039 GCCATCCACGTGCCCCCTCAGGG + Intronic
1173809782 20:45948772-45948794 GGCAGCCATGGGCCCCAGCCAGG - Exonic
1173939077 20:46894778-46894800 GCCCTCCCTCTGCCCCCGCCCGG - Exonic
1174382971 20:50169231-50169253 GCCACCCATGTGCCCTCTCTGGG + Intergenic
1175894606 20:62330577-62330599 ACCACCCATGTGCCCACGCTGGG - Exonic
1175987320 20:62770531-62770553 TCCTCCCATCTGCCCCCTCCAGG - Intergenic
1176020986 20:62962374-62962396 GCCACGCATGTGTCCCAGTCGGG - Intronic
1176310222 21:5145376-5145398 GTCACCCGGGTGCCCCAGCCTGG - Intronic
1179451805 21:41473281-41473303 GCCAGCCCTGAGCCCCCACCCGG + Intronic
1179846834 21:44116660-44116682 GTCACCCGGGTGCCCCAGCCTGG + Intronic
1180118428 21:45727469-45727491 GCTTCCCATGTGGCCCTGCCTGG - Intronic
1180911945 22:19456776-19456798 GCCACCCACGAGCCACTGCCAGG + Intronic
1180933933 22:19611672-19611694 GCCACCCAGGGGCCGCCGCTTGG - Intergenic
1181166630 22:20987482-20987504 ACCACCCCTGTGCCCACCCCAGG + Exonic
1181627777 22:24133216-24133238 GCTACCCTTCTGCCCCCACCGGG - Intronic
1181952134 22:26562125-26562147 GCCACCCTGTGGCCCCCGCCGGG - Intronic
1184176859 22:42793714-42793736 GCCACCTGTGTGCCCTCGCATGG - Intergenic
1184508099 22:44916464-44916486 GTCAGCCATGTGCCAGCGCCCGG - Exonic
1184593801 22:45502680-45502702 GCCCCCTCTGTGCCCCCTCCGGG + Intronic
1184769348 22:46588619-46588641 GCCACCCCTGCCCCCCAGCCAGG - Intronic
1184785177 22:46668203-46668225 GCCAGCCATGGGCACCAGCCAGG + Intronic
1185281642 22:49972309-49972331 GCCTCCCCTGCGCCCCAGCCTGG + Intergenic
949918827 3:8985677-8985699 GCCAGCCCTGTCCGCCCGCCTGG - Exonic
950006664 3:9695875-9695897 GCCTGCCCTGTGCCCCCTCCAGG - Intronic
954405029 3:50340856-50340878 GCCCGCCCTGTGGCCCCGCCCGG - Intronic
954414343 3:50385676-50385698 GCCACCCATCTGCCCACCCCTGG + Intronic
954576252 3:51677942-51677964 TACACCCATGAGCCCCTGCCAGG - Intronic
960055538 3:113274141-113274163 GCCACCCCTGAGCCCTGGCCAGG + Intronic
962265971 3:133944614-133944636 GCCAGCCATGTGGCCACACCTGG + Intronic
962869236 3:139473773-139473795 CCCACCCATGTTCCCACGGCAGG + Intronic
968288513 3:197521952-197521974 ACCAGCCATGTTCCCTCGCCTGG + Intronic
968887117 4:3341037-3341059 GCCACCACTGGGCCCCCACCAGG - Intronic
969032727 4:4227176-4227198 GGCAGCCATCTGCCCCCTCCGGG + Intergenic
969374291 4:6753090-6753112 CCCACCCAGGTCCCCCCGCAGGG - Intergenic
971537388 4:27770940-27770962 ACCAGCCATGTGCCCCAGCCAGG - Intergenic
976475193 4:85475301-85475323 GCCACCCAGCCACCCCCGCCAGG - Exonic
985818129 5:2141791-2141813 ACCACCCAGGTGCCCCCTCCTGG - Intergenic
986076650 5:4344628-4344650 GCCACCCATGATCCCACGGCAGG - Intergenic
991588694 5:68226091-68226113 TCCTCCCCTCTGCCCCCGCCCGG + Intronic
992401076 5:76411961-76411983 GCCCCCCATGTGCCACCCCCAGG - Intronic
995944931 5:117633315-117633337 GGCACCCATATGCCCCACCCAGG - Intergenic
1001526601 5:172433580-172433602 GCCACCAAGGAGCCCCTGCCGGG + Intronic
1002306043 5:178283956-178283978 GCCACCCCAGTGCCCAGGCCAGG + Intronic
1004104442 6:12652915-12652937 GCCAGCCATGCACCCCAGCCTGG - Intergenic
1006072577 6:31507990-31508012 CCCACCCGTGTGCCTCCTCCAGG + Intronic
1006367082 6:33621990-33622012 GCCACCCACCTGCCCGCCCCCGG - Intronic
1006837367 6:37007082-37007104 GCCACCCATGTCCCTCCTTCAGG - Intronic
1006941257 6:37753711-37753733 GCCCCCCACGCGCCCCTGCCTGG - Intergenic
1011129430 6:84038128-84038150 TCCTCCCATGTGGCCCCACCTGG - Intronic
1014482154 6:121952130-121952152 GCCTGCCATGTGCCCATGCCGGG + Intergenic
1018378910 6:163240168-163240190 GCCGCACCTGTGCCTCCGCCGGG + Intronic
1019391776 7:791903-791925 GGCACCCTTGTGCTCCAGCCTGG - Intergenic
1019736073 7:2650255-2650277 GCCACCCATTTGGCCTCCCCTGG - Intronic
1019925820 7:4191248-4191270 GACACCCATGTGACCGCGGCGGG - Intronic
1021600003 7:22356042-22356064 GCCACCTAGGAGGCCCCGCCAGG - Intronic
1023714895 7:43033993-43034015 GAAACCCATGTGCCCACGCAGGG + Intergenic
1023861112 7:44218173-44218195 GCCTCCCATGTGCCCTAGGCTGG + Exonic
1028207976 7:88038822-88038844 GGCACCACTGTGCTCCCGCCTGG - Intronic
1029481887 7:100818448-100818470 GCAACCCAGGTGTCCCAGCCAGG + Intronic
1029537798 7:101166198-101166220 TCCACCCATCTGCCCCTGTCAGG - Intergenic
1031406686 7:121395837-121395859 GCGACCCAGGTGCCCGCCCCAGG + Intronic
1034447213 7:151119874-151119896 GCTGCCCATGAGCCCCGGCCAGG + Intronic
1035043203 7:155945888-155945910 GCCACCCAGGAGCCTCCGCAGGG + Intergenic
1035244712 7:157554410-157554432 GCCAACGTTGTGCCCCTGCCCGG - Intronic
1035591847 8:822287-822309 GTCACCCCTGTGCCCCTCCCCGG - Intergenic
1036930428 8:12951404-12951426 GCCGACCAGGTGCTCCCGCCGGG + Intronic
1038804330 8:30776604-30776626 GCAACCCCAGTGCCCCCGCGAGG + Intronic
1049508504 8:143016157-143016179 GCCGCCCACGTGGCCCCTCCAGG - Intergenic
1049569626 8:143363058-143363080 GCCACCCATCAGCCCTCCCCTGG + Intergenic
1053011704 9:34637420-34637442 GCCGCCCCTCTGCCTCCGCCAGG - Exonic
1053269349 9:36739661-36739683 ATCACCCAGGTGCGCCCGCCGGG - Intergenic
1056520529 9:87397069-87397091 GGCACCACTGTGCTCCCGCCTGG - Intergenic
1059435769 9:114275418-114275440 GGCTCCCATGTGTCCCTGCCTGG - Intronic
1060106474 9:120876427-120876449 GCCACCCGGGGGCCCCCGCCCGG - Intronic
1061373872 9:130212854-130212876 GCCACCCATCTGCCACCGGCTGG - Intronic
1061644943 9:131993571-131993593 GCTCCCCATGTGCCCCCACTCGG - Intronic
1061793533 9:133071171-133071193 GCCACCCCTGTGCCCCCCACAGG + Exonic
1061793757 9:133071666-133071688 GCCCCCCCTGTGCCCCCCACGGG + Exonic
1062255572 9:135619220-135619242 GCCAGCAGTGTGCCCCAGCCTGG + Intergenic
1062428817 9:136517937-136517959 CTCACCCGTGTGCCCTCGCCAGG - Exonic
1203790067 EBV:146553-146575 GCCACCCCTGTGCCACGCCCTGG + Intergenic
1203364974 Un_KI270442v1:248845-248867 GCCACCGACCTGCCCCCACCCGG - Intergenic
1185747306 X:2583655-2583677 GCCCCCCCTGTACCCCCTCCAGG - Intergenic
1190333406 X:49249130-49249152 GGCAGCCATGAGCCCCTGCCTGG - Intronic
1194161607 X:90459213-90459235 GCCACCCCTGTGCCCCACCAAGG - Intergenic
1198281603 X:135148271-135148293 GCCACACATGTGTGCCCTCCAGG - Intergenic
1198289356 X:135224251-135224273 GCCACACATGTGTGCCCTCCAGG + Intergenic
1198697220 X:139354878-139354900 GCCATCCATGTGCCAAGGCCTGG + Intergenic
1200114583 X:153764597-153764619 GCCACCCAACTGGCCCAGCCAGG + Intronic
1200507895 Y:4036946-4036968 GCCACCCTTGTGCCCCACCAAGG - Intergenic