ID: 1129740099

View in Genome Browser
Species Human (GRCh38)
Location 15:77985966-77985988
Sequence GTCCCCACCAGGTCTAGATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 3, 2: 0, 3: 8, 4: 65}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129740099_1129740113 25 Left 1129740099 15:77985966-77985988 CCCGATCTAGACCTGGTGGGGAC 0: 1
1: 3
2: 0
3: 8
4: 65
Right 1129740113 15:77986014-77986036 AGCCATCCTGCACCCTCCACGGG 0: 1
1: 0
2: 1
3: 26
4: 296
1129740099_1129740112 24 Left 1129740099 15:77985966-77985988 CCCGATCTAGACCTGGTGGGGAC 0: 1
1: 3
2: 0
3: 8
4: 65
Right 1129740112 15:77986013-77986035 CAGCCATCCTGCACCCTCCACGG 0: 1
1: 0
2: 0
3: 26
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129740099 Original CRISPR GTCCCCACCAGGTCTAGATC GGG (reversed) Intronic
902553037 1:17230487-17230509 GTCCCCACCAGGCCTGGGGCAGG - Intronic
903799715 1:25957606-25957628 GTCCCCACAAGGTCAAGACACGG + Intergenic
910451342 1:87349088-87349110 CTCCCCAGCAGGTTTTGATCTGG - Intergenic
912926615 1:113918682-113918704 CTCCCCACCAGGTCTTCACCTGG - Intergenic
1073057956 10:100714110-100714132 TTCCCCGCCAGGTCCAGATTGGG + Intergenic
1077309930 11:1883784-1883806 CTCCCCACCAGCTCCAGAACTGG + Intronic
1085448659 11:76617549-76617571 GGCCATTCCAGGTCTAGATCTGG + Intergenic
1086340376 11:85842664-85842686 GGCCCACCCAGGTCTAGGTCAGG - Intergenic
1090644785 11:128758629-128758651 GTCCCCAACAGGACTGGACCTGG - Intronic
1092003419 12:5049321-5049343 GTCCCCAGCAGGGCAAGATGAGG - Intergenic
1092613795 12:10198144-10198166 TTTCCCTCCAGGTCTAGCTCAGG + Intergenic
1096685525 12:53286046-53286068 GTGGCCACCAGCTCTAGAGCAGG - Exonic
1096774637 12:53956478-53956500 GTGACCAGCAGGTCAAGATCTGG + Exonic
1103698317 12:122834976-122834998 GTCTGCACCAGGGCAAGATCTGG - Intronic
1115106338 14:29765929-29765951 GTCACCCCCAGGTCTAGAAAAGG - Intronic
1117460258 14:55938322-55938344 GTCGCCAGCAGGTCTAGAAGTGG - Intergenic
1119323779 14:73746639-73746661 CTCCCCAGCAGGGCTAGAGCAGG + Intronic
1120551215 14:85875405-85875427 ATCCCCACCGGGTCCACATCAGG - Intergenic
1129740099 15:77985966-77985988 GTCCCCACCAGGTCTAGATCGGG - Intronic
1129845658 15:78766639-78766661 GTCCCCGCCAGGTCTAGATCGGG + Exonic
1130256200 15:82327222-82327244 GTCCCCGCCAGGTCTAGATCGGG - Intergenic
1130598753 15:85262765-85262787 GTCCCCGCCAGGTCTAGATCGGG + Intergenic
1130812493 15:87394563-87394585 AGCCCCACCAGTTCTAGGTCAGG - Intergenic
1135527262 16:23223432-23223454 GTCCCCTCCAGGCCTACCTCTGG + Intergenic
1139469777 16:67171937-67171959 TTCCCCACCAGGCCGAGACCAGG - Intronic
1141611995 16:85187108-85187130 GTCGCCTCCAGGTCTGGAGCCGG + Intergenic
1145976361 17:28986398-28986420 AGCCCCACCAGATCTGGATCGGG + Intronic
1147234301 17:39045855-39045877 CTCCCCACCACGCCTAGATGTGG - Intergenic
1148640122 17:49181136-49181158 CTGCCCACCAGATGTAGATCTGG - Intergenic
1149434311 17:56620075-56620097 GTCCCCACCCTGCCCAGATCTGG - Intergenic
1149448007 17:56728752-56728774 TTCCCCACCAGGTATAAAACTGG - Intergenic
1152734246 17:81989373-81989395 GTCCCCAGCAGGTCTGCATGAGG + Intronic
1158064204 18:53386117-53386139 GCCACCACCAGGTCTATAACCGG + Exonic
1161688693 19:5718127-5718149 GACCCCACAAGGTCTTGCTCTGG + Intronic
1167666361 19:50824561-50824583 TTCCCTCCCAGGTCAAGATCAGG + Intergenic
928389439 2:30897852-30897874 GTCCCAAACAGGTTAAGATCAGG - Intergenic
928405844 2:31014289-31014311 GTACCCATCAGCTCTGGATCTGG + Intronic
934088391 2:88529429-88529451 GTCCCCACCGGTTCAAGATGGGG - Exonic
946022804 2:216653103-216653125 TTCCTCACCAGGTCTGGATAAGG + Intronic
946197115 2:218040278-218040300 GTCCCAACCATGTCTACATCTGG - Intronic
948066245 2:235082989-235083011 CTCCCCATCGGGTCTTGATCTGG + Intergenic
1172208019 20:33178252-33178274 GCCCCCACCAGGCCTGGATCTGG - Intronic
1172545403 20:35757010-35757032 GTGCCCACGAGTTCAAGATCAGG - Intergenic
1173305976 20:41850078-41850100 TTCTCCATCAGGTCTAGATGTGG + Intergenic
1174118338 20:48243277-48243299 GTCCACACCAGGTAGAAATCAGG - Intergenic
1180594604 22:16964974-16964996 GTCCCTATCAGTTCTTGATCTGG - Intronic
1182286886 22:29254041-29254063 GTCCTCACCTGGTCTTGTTCTGG + Intronic
1183019538 22:35016190-35016212 GTCCCCACCAAGTTGTGATCTGG + Intergenic
1184176629 22:42792803-42792825 GTCCCTGCCAGGTCTAGGTCAGG + Intergenic
956149404 3:66225130-66225152 GTCCCCACCAGGTCACCACCTGG - Intronic
977397206 4:96485816-96485838 GTCCCCAACATGTGTAGTTCAGG + Intergenic
978828303 4:113051108-113051130 ATGCCCTCAAGGTCTAGATCTGG - Intronic
981520611 4:145657999-145658021 GTTCACACGAGGTCTAGATCTGG + Exonic
987168472 5:15225997-15226019 GTCCCCACTAGTTCTAGCTGAGG - Intergenic
997180462 5:131823694-131823716 GACCCCACCAGATCTAAATAAGG - Intronic
998231731 5:140365216-140365238 GTTTCCACCAGGGCTAGAACTGG - Intronic
998407736 5:141883405-141883427 GTCCCCACCAGATCTCCATCGGG + Intergenic
1000989345 5:167896130-167896152 CTCCCCACCTGGGCTAGAGCTGG + Intronic
1005923368 6:30419224-30419246 GTCCCAACCAGGTGTTGATCTGG - Intergenic
1014224427 6:118831578-118831600 GTACCCACCAGGTTTACATATGG - Intronic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1029544355 7:101202413-101202435 GTCCCCACCGGGTCACGCTCGGG + Intergenic
1031941511 7:127794250-127794272 GTCCCTCCAAGGTCTAAATCAGG - Intronic
1045403199 8:101839251-101839273 GTGTCCCCAAGGTCTAGATCTGG - Intronic
1047865222 8:129016372-129016394 GTCCCCACCAGGTCCCCACCAGG + Intergenic
1049210701 8:141385182-141385204 GTCCCCACCAGGCCCAGAAGAGG - Intergenic
1052759666 9:32577510-32577532 GTCCAAACCAGGTCTAAATAAGG + Intergenic
1056271836 9:84954745-84954767 GTCCCCACCAGCACCAGAGCTGG - Intronic
1056569138 9:87800572-87800594 TTCCCCACCAGGTCTGGATTGGG - Intergenic
1057600284 9:96450957-96450979 GTCCCCGCCAGGTCTGGATGTGG - Intronic
1060733859 9:126053981-126054003 GTCTCCTCCAGGTAGAGATCTGG + Intergenic
1186489595 X:9961126-9961148 CTCCCCACCAGCCCTAGAACTGG - Intergenic
1189857180 X:45235148-45235170 GTGCTCACTAGGTCCAGATCAGG - Intergenic
1189992804 X:46610572-46610594 GGCCCCACCATGTCTGGAGCTGG + Intronic
1190297088 X:49034057-49034079 GTGCCTACCAGGTCTAGAGATGG - Intronic
1194494394 X:94594147-94594169 GACCCCACCAGGACTAGAAGCGG + Intergenic
1195124326 X:101790490-101790512 CTCCCCACCATGTATAGTTCAGG + Intergenic