ID: 1129741334

View in Genome Browser
Species Human (GRCh38)
Location 15:77991082-77991104
Sequence CTGGCTGAGGACTCTTTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 1, 2: 4, 3: 14, 4: 254}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129741334_1129741339 -2 Left 1129741334 15:77991082-77991104 CCTAGAAAAGAGTCCTCAGCCAG 0: 1
1: 1
2: 4
3: 14
4: 254
Right 1129741339 15:77991103-77991125 AGGGCACTCACGCTGACATTCGG 0: 1
1: 0
2: 0
3: 5
4: 81
1129741334_1129741341 0 Left 1129741334 15:77991082-77991104 CCTAGAAAAGAGTCCTCAGCCAG 0: 1
1: 1
2: 4
3: 14
4: 254
Right 1129741341 15:77991105-77991127 GGCACTCACGCTGACATTCGGGG 0: 1
1: 0
2: 1
3: 3
4: 45
1129741334_1129741342 19 Left 1129741334 15:77991082-77991104 CCTAGAAAAGAGTCCTCAGCCAG 0: 1
1: 1
2: 4
3: 14
4: 254
Right 1129741342 15:77991124-77991146 GGGGCCTCCTGCGATCTCCCCGG 0: 1
1: 0
2: 0
3: 10
4: 215
1129741334_1129741340 -1 Left 1129741334 15:77991082-77991104 CCTAGAAAAGAGTCCTCAGCCAG 0: 1
1: 1
2: 4
3: 14
4: 254
Right 1129741340 15:77991104-77991126 GGGCACTCACGCTGACATTCGGG 0: 1
1: 0
2: 0
3: 5
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129741334 Original CRISPR CTGGCTGAGGACTCTTTTCT AGG (reversed) Intronic
900917758 1:5650585-5650607 CTGGCTGAGCACTCTGTGATGGG - Intergenic
900967270 1:5967377-5967399 GTGGCTGACGACTGTTCTCTGGG - Intronic
909112970 1:71503356-71503378 CTGGGTGAGGGCTTTTTACTAGG - Intronic
910035183 1:82780119-82780141 CAAGCTGGGGACTCTTGTCTGGG - Intergenic
914667002 1:149840498-149840520 CGGGCTGCGGACGCTTTCCTGGG - Exonic
914668765 1:149853292-149853314 CGGGCTGCGGACGCTTTCCTGGG + Exonic
914727597 1:150341195-150341217 CAAGCTGAGGGCTCTTTCCTAGG - Intronic
915092757 1:153438069-153438091 ATGTCTGAGGACTCATCTCTGGG - Intronic
915432135 1:155874928-155874950 CTGGCTGAGGATACTTTCCATGG + Intronic
916300393 1:163267288-163267310 CCTGGTGAGGACTCTCTTCTTGG - Intronic
918310048 1:183279372-183279394 CTGGGTGAGGACTCTCCTCACGG - Intronic
919353352 1:196488927-196488949 CTGGCTTAGGAGTATCTTCTGGG - Intronic
920315891 1:205075369-205075391 CTTGCTTTGGCCTCTTTTCTTGG - Exonic
920736833 1:208540475-208540497 CTGAATGAAGACTCTTTTTTAGG - Intergenic
921262502 1:213396472-213396494 CTGACTGAGGACCCATCTCTGGG + Intergenic
923675959 1:236081032-236081054 CTGGCTGAGGAATATTCTGTGGG + Intergenic
1062917401 10:1251782-1251804 CTGTCTGAAGTCTCTTTTATAGG - Intronic
1063101675 10:2955234-2955256 TTCGGTGAGGACTCTCTTCTTGG + Intergenic
1064184188 10:13146547-13146569 CTGGGTGAGGGCTCTTTCCTTGG - Intergenic
1064713380 10:18150365-18150387 CCGGCTGAGGAGGGTTTTCTTGG - Intronic
1065784209 10:29198498-29198520 CTTGATGAGGGCTCTCTTCTGGG - Intergenic
1065969362 10:30794229-30794251 CTGGCTCAGGTGTCTTTACTAGG - Intergenic
1068981832 10:63070890-63070912 CTGGCTCAGGGCTTTTTTTTGGG - Intergenic
1069686536 10:70322605-70322627 CTGTTTGAGGACTCTGGTCTTGG + Intronic
1069788338 10:71004065-71004087 TTTCCTGAGGACTGTTTTCTAGG + Intergenic
1069999405 10:72365179-72365201 TTGCCTGAGGACTTTTTCCTTGG + Intergenic
1071012265 10:80952879-80952901 TTGGCTGGGGACTCTTAACTAGG - Intergenic
1071348325 10:84714717-84714739 TCTGTTGAGGACTCTTTTCTTGG + Intergenic
1072465708 10:95660487-95660509 CTGGTTCAGGACTCCATTCTTGG + Intergenic
1073208203 10:101779734-101779756 CTGGCTGAGTCCTCTCTCCTGGG - Intronic
1074713869 10:116200629-116200651 CTTGGTGAGGACTCTCTTCCTGG + Intronic
1077129555 11:963996-964018 CTGGCTGACGCCTCTGTTGTGGG - Intronic
1077170699 11:1164680-1164702 CTGGCTGAGGATCCTGTCCTGGG + Intronic
1077170710 11:1164713-1164735 CTGGCTGAGGCCCCTCTCCTGGG + Intronic
1077170740 11:1164810-1164832 CTGGCTGAGGCCCCTGTCCTGGG + Intronic
1077170752 11:1164842-1164864 CTGGCTGAGGATCCTGTCCTGGG + Intronic
1077170809 11:1165004-1165026 CTGGCTGAGGATCCTGTCCTGGG + Intronic
1077170820 11:1165037-1165059 CTGGCTGAGGCCCCTGTCCTGGG + Intronic
1080621721 11:33992391-33992413 CAGGCTAAGGCCTCTTTCCTTGG + Intergenic
1081690848 11:45077060-45077082 ATGTCTGAGTAGTCTTTTCTGGG - Intergenic
1084267148 11:68010887-68010909 CTGGCTGGCCACTCCTTTCTTGG - Intronic
1085265907 11:75237864-75237886 CTGGTGGAAGTCTCTTTTCTTGG - Intergenic
1085940087 11:81198082-81198104 CTGGGTGAGGGCTCTTCACTAGG - Intergenic
1086449545 11:86902429-86902451 TTGGGTGAGGACCCTTATCTAGG - Intronic
1086862972 11:91947156-91947178 CAGACTGAGGTCTCATTTCTAGG + Intergenic
1089139252 11:116273135-116273157 CATGCTGAGGACTCTCTCCTGGG - Intergenic
1090090349 11:123691299-123691321 CTGTCTGAAGACTCTTCACTTGG + Intergenic
1090132743 11:124161773-124161795 ATGGCTGAGGAGTATTTTCCAGG + Intergenic
1090201691 11:124862157-124862179 CTGGCCCAGGGCTCTTTTCTAGG + Intergenic
1090973986 11:131666681-131666703 GAGGCTGAGGACTCTGTTGTGGG - Intronic
1091588592 12:1829785-1829807 CTGGCTGGGGTCTTTTCTCTAGG + Intronic
1092680999 12:10981222-10981244 TTCTCTGAGGACTGTTTTCTGGG - Intronic
1094714589 12:32999979-33000001 ATGGTTGAGGCCTCTTTTGTAGG + Intergenic
1096028279 12:48387217-48387239 CTGGATGGAGACTCTTTTGTGGG + Intergenic
1096361880 12:50994942-50994964 TTGACTGAGGATTCTATTCTGGG - Intronic
1097409841 12:59238165-59238187 CTTTCTGAGGCCTCTTCTCTTGG - Intergenic
1098816401 12:75170709-75170731 TTGGCTGAGAACTCTCTTCCTGG - Intronic
1099349203 12:81543718-81543740 CTGGCTGAGGAATTGTTTGTCGG - Intronic
1103627317 12:122229931-122229953 CTGGCTGGGGATTCTGTCCTGGG - Exonic
1104382381 12:128318865-128318887 CTGCTGGAGTACTCTTTTCTTGG - Intronic
1106881557 13:34137464-34137486 CTCACTGAGAACTCTTTTCCAGG + Intergenic
1107554443 13:41505198-41505220 TTGGCTGAGGAATCTGCTCTTGG + Intergenic
1113404536 13:110025976-110025998 CATGCAGAGGACTTTTTTCTGGG - Intergenic
1113412318 13:110101155-110101177 TTTGGTGAGGTCTCTTTTCTGGG + Intergenic
1115822541 14:37226843-37226865 CTGGCTTAGGACTCCTTTCTGGG + Intronic
1116222181 14:42102275-42102297 TTGCTTGAGGACTCTCTTCTTGG + Intergenic
1118773096 14:68955445-68955467 CTGACTGTGGACTGTTGTCTGGG - Intronic
1119435212 14:74594159-74594181 CTGGGTGGGGACTGCTTTCTAGG + Intronic
1121297956 14:92845168-92845190 CTGTCTGGGGCCTCTTTTATGGG + Intergenic
1122349016 14:101077187-101077209 CTGGCTCTGGGCTCTATTCTCGG - Intergenic
1124256667 15:28148451-28148473 CTTGCTTAGCAGTCTTTTCTGGG - Intronic
1126132303 15:45353561-45353583 CTTCCTTAGGACTCTTTTCAAGG - Intergenic
1126451995 15:48818479-48818501 CTCTCTGAGGCCTCTTTTATAGG + Intergenic
1128243747 15:66118968-66118990 CTGGCTGAGGACTGCTGCCTAGG + Intronic
1129367387 15:75064761-75064783 CTGGGTGAGGGCTTTTTACTAGG - Intronic
1129741334 15:77991082-77991104 CTGGCTGAGGACTCTTTTCTAGG - Intronic
1129821402 15:78604485-78604507 TTGGCTGATGGCTCATTTCTGGG + Intronic
1129834446 15:78693177-78693199 TTGGGTGAGGACTCTTTTCTTGG - Intronic
1129844329 15:78761317-78761339 CTGGCTGAGGACTCTGTCCTAGG + Intronic
1130257473 15:82332462-82332484 GTGGCTGAGGACTCTGTCCTAGG - Intergenic
1130597471 15:85257503-85257525 GTGGCTGAGGACTCTGTCCTAGG + Intergenic
1131468729 15:92676591-92676613 CTGGTTGAGGATTCTCTTCCAGG - Intronic
1132722883 16:1325687-1325709 CTGCCTGAGGACTCCTATCCGGG + Exonic
1133913531 16:10087464-10087486 CTGACGGAGGGCTCCTTTCTAGG - Intronic
1134093083 16:11401932-11401954 CTGCCTGAGGAGCCTTATCTGGG - Intronic
1134782167 16:16908002-16908024 CTGGCTTGGGACTCTTTTGAAGG + Intergenic
1138834193 16:60413327-60413349 TTTGGTGAGGACTCTCTTCTGGG - Intergenic
1139542986 16:67632456-67632478 CAGGCTGACGTCCCTTTTCTGGG - Intronic
1140737692 16:77912833-77912855 CTTGGTGAGGGCTCTCTTCTTGG + Intronic
1141009120 16:80380828-80380850 CTTGGTGAGGACTCTTTTGCTGG - Intergenic
1141338577 16:83181178-83181200 TTGCCTGAGGCCTCATTTCTTGG - Intronic
1141711057 16:85699203-85699225 CTGGCTGAGGACTCTGAGCTGGG - Intronic
1142980289 17:3667679-3667701 CTGGCTGAGCACTTCTCTCTGGG + Intronic
1143451296 17:7038388-7038410 CTGGCTGAGGACCCTGCTGTGGG + Exonic
1144253567 17:13443519-13443541 CTCTCTGAGGTCTCTTTTATAGG - Intergenic
1146449993 17:32965326-32965348 CTGGGTGAGGACTTTTTACTAGG - Intergenic
1147708703 17:42447422-42447444 TTTCCTGAGGCCTCTTTTCTTGG + Intergenic
1148884689 17:50763720-50763742 TTAGCTGAGGGTTCTTTTCTTGG + Intergenic
1149605549 17:57922488-57922510 CTGGCTGAGGATTCTCTTCTCGG - Intronic
1151091128 17:71441166-71441188 CTGGGTGGGGACTCCTGTCTCGG + Intergenic
1151107323 17:71631409-71631431 GTGTCTGTGGACTCTTTTCTTGG + Intergenic
1151433523 17:74080573-74080595 CTGGCCGAGGACCCCATTCTTGG - Intergenic
1152162238 17:78675990-78676012 CTGGCAGAGGACGCTCTGCTCGG + Exonic
1152735523 17:81995262-81995284 CTGGCTGAGTGCCCTTTGCTGGG + Intronic
1152747476 17:82048095-82048117 GTGGCTCAGGACTACTTTCTGGG - Exonic
1153978602 18:10290703-10290725 CTGGCTCAGGACTGTCCTCTGGG - Intergenic
1154162953 18:11993644-11993666 CTGGCTGAGGCCCCTCTTCCTGG - Intronic
1155058150 18:22203752-22203774 CTGTCTGGGGTCTCTTTTCAGGG + Intergenic
1155397200 18:25398891-25398913 CTCTGTGAGGGCTCTTTTCTTGG - Intergenic
1155684946 18:28537130-28537152 CTTGGTGAGGGCCCTTTTCTGGG + Intergenic
1156167826 18:34444361-34444383 CTGGCTGAGGACATTTTCCATGG + Intergenic
1157876791 18:51281243-51281265 CTTGGTGAGGGCTCTTTTCCTGG + Intergenic
1159529214 18:69634643-69634665 TTGGCTGCTGACTCTTTGCTTGG + Intronic
1160721102 19:597208-597230 TGGGCTGAGGAGTCCTTTCTGGG + Intronic
1162738799 19:12762012-12762034 CTTGGTGAGGCCTCCTTTCTGGG + Intergenic
1162994464 19:14325356-14325378 CCTGGTGAGGACTCTCTTCTTGG + Intergenic
1163029297 19:14533611-14533633 CTGGTTGAGGACTGTTATCATGG + Intronic
1165406354 19:35633549-35633571 CTGGCTGGAGACTCTCTGCTTGG + Intronic
1166119729 19:40678555-40678577 CTTGGTGAGGGCTCTTTTCCTGG - Intronic
1168605679 19:57758381-57758403 CAGGCTGAGGCCCCTATTCTAGG + Intergenic
929379167 2:41329657-41329679 CTCTCTGAGCCCTCTTTTCTAGG - Intergenic
930221418 2:48750212-48750234 CTGTCTGTGGATTCTTTCCTGGG + Intronic
930330826 2:49980923-49980945 ATGGCTGAGGACTTTTCTCTGGG - Intronic
932109317 2:68980671-68980693 CTATTTAAGGACTCTTTTCTTGG - Intronic
932369387 2:71174860-71174882 CTGGATGAGGACTCTTTTCTTGG - Intergenic
932981197 2:76669474-76669496 CTGCTTCAGGACTCTTTTCCCGG - Intergenic
933180702 2:79223251-79223273 TTTGGTGAGGACCCTTTTCTGGG - Intronic
933936910 2:87213459-87213481 TTGGCTGGGGAAGCTTTTCTTGG + Intergenic
934151686 2:89153433-89153455 CTGGCAGTGGACTCTATGCTTGG - Intergenic
934215573 2:90028473-90028495 CTGGCAGTGGACTCTATGCTTGG + Intergenic
934945144 2:98535453-98535475 GTGCCTGAGGACTCATTTCATGG - Intronic
936356233 2:111752366-111752388 TTGGCTGGGGAAGCTTTTCTTGG - Intergenic
937060864 2:118979544-118979566 CTGGCTGAGGCCCCTTCTCTGGG - Intronic
939076767 2:137612250-137612272 CTCACTGTGGACTGTTTTCTGGG - Intronic
939993251 2:148896228-148896250 CTCGCTGAGAGCTCTCTTCTAGG - Intronic
940160108 2:150702561-150702583 CAGGCTGAGGACTCTCCTATGGG + Intergenic
940938435 2:159527340-159527362 CTGACAAAGGACTCTTATCTAGG - Intronic
941094657 2:161223939-161223961 CTTGCTGAAGTTTCTTTTCTAGG - Exonic
942427916 2:175878905-175878927 CTCTTTTAGGACTCTTTTCTGGG - Intergenic
944684986 2:202110162-202110184 CTGTCTGGGGACTCTTCTGTTGG - Intronic
944701716 2:202251769-202251791 CTTGGTGAGGACTTTCTTCTTGG + Intergenic
945427591 2:209725722-209725744 ATGGCTTAGGTCTATTTTCTTGG - Exonic
947127287 2:226882862-226882884 CTTGTTGAGGCCTCTCTTCTAGG + Intronic
947555651 2:231090870-231090892 ATGGCTGAGGAGTTGTTTCTTGG + Intronic
948899137 2:240947344-240947366 CTGGCTGGGGCCTGTGTTCTGGG - Intronic
1172930907 20:38585949-38585971 CTGGCAGGGGACTCCTTCCTGGG + Intronic
1173330503 20:42072245-42072267 TTGGCTAAGGGCTCTATTCTAGG - Intergenic
1174251139 20:49220544-49220566 CTGCCTGAGGAGTCTTTGCAAGG - Intronic
1175276235 20:57772774-57772796 CAGGCTGAGGACCTTTTCCTTGG + Intergenic
1175477668 20:59288418-59288440 CCGGCTGTGGACTTTTTTCTAGG + Intergenic
1178141890 21:29693701-29693723 GTTGCTGAGCACTGTTTTCTGGG - Intronic
1179267284 21:39814944-39814966 CCTGGTGAGGGCTCTTTTCTTGG - Intergenic
1183330582 22:37218736-37218758 CTGGCTGAATACTCCTTGCTGGG + Intergenic
1183986628 22:41573866-41573888 CTGGCTGAGGTCTGTATTCATGG + Intronic
1184286340 22:43473806-43473828 CTGGCTGGGGGCTGGTTTCTCGG - Intronic
951997543 3:28747931-28747953 CTGGTTGAGGACTCCTCTCAAGG + Intergenic
952928514 3:38340981-38341003 CCTGGTGAGGGCTCTTTTCTTGG - Intergenic
955609612 3:60743156-60743178 CTGGCTGAGGTCACATTTTTAGG + Intronic
955713632 3:61805593-61805615 CCCTCTGAGGACTGTTTTCTGGG + Intronic
956380828 3:68662816-68662838 CTGGGTGAGGGCTCTCTTCCTGG - Intergenic
957311149 3:78520437-78520459 CTGTCTCAGGCCTCTTTTATAGG - Intergenic
960840526 3:121954345-121954367 CTGGCTTGGGACCCCTTTCTGGG - Intergenic
960984249 3:123263285-123263307 CTTGCTGAGGGCCCTTTTCCTGG + Intronic
962350831 3:134654587-134654609 CTGGCTGAGGAAAGGTTTCTGGG - Intronic
962894971 3:139705846-139705868 CTTACTGAGGAGTCTATTCTTGG + Intergenic
964274674 3:154997231-154997253 CCTGATGAGGACTCTCTTCTTGG + Intergenic
964330701 3:155599070-155599092 CCTGGTGAGGACTCTTTTCCTGG - Intronic
967480144 3:189963227-189963249 CTAGCTGAGGACACTTAGCTAGG - Intronic
967631002 3:191742873-191742895 CTGGGTGAGTGCTCTTTGCTAGG + Intergenic
967931476 3:194693510-194693532 CTGGCTGATGCCTCTGTGCTTGG - Intergenic
968517562 4:1021245-1021267 CTGGCAGAGGCCTCCTTTCCTGG - Intronic
968758767 4:2430639-2430661 CTGGCTTAGTACTTTTTTTTGGG - Intronic
970072498 4:12177293-12177315 CTGGATCAGGACCCCTTTCTAGG + Intergenic
970096826 4:12473127-12473149 CCGGATGAGGGCTCTTTTCCTGG + Intergenic
970128966 4:12845319-12845341 CTTCCTGAGGCCTCTTCTCTTGG - Intergenic
970573805 4:17408060-17408082 TTGGCTTAGGACACTTTTTTGGG - Intergenic
971623123 4:28882854-28882876 CTGGAGGAAGAGTCTTTTCTTGG - Intergenic
972128040 4:35794003-35794025 CTTGCTGAGTGCTCTATTCTTGG - Intergenic
972990457 4:44817232-44817254 CTTTCTGGGGTCTCTTTTCTAGG + Intergenic
974804651 4:66862143-66862165 TATTCTGAGGACTCTTTTCTTGG + Intergenic
975725781 4:77290483-77290505 CTGGCTGAGGACTCTTCCTGGGG + Intronic
975726194 4:77294095-77294117 ATGGCTAATGACTCTATTCTGGG + Intronic
976836912 4:89385151-89385173 CTGGCTTAGCACTCTGTCCTGGG + Intergenic
980824924 4:138061756-138061778 GAGGCTGATGACTCTCTTCTCGG + Intergenic
980905684 4:138946554-138946576 TTGGCTGAGGACTCTCTTCCTGG - Intergenic
981125430 4:141100696-141100718 TTGGCTCAGGACACCTTTCTTGG - Intronic
982392211 4:154877064-154877086 CCAGGTGAGGGCTCTTTTCTTGG - Intergenic
982590723 4:157305902-157305924 CTGCCTGGGCACTCTTTTCCTGG - Intronic
982888163 4:160810120-160810142 CTGACTGAGACCTCTTTTATAGG + Intergenic
983336860 4:166405959-166405981 CAGGCTAAGCATTCTTTTCTTGG - Intergenic
984847777 4:184122316-184122338 CTAGCTGGGGACCCTTTCCTGGG + Intronic
985185252 4:187307472-187307494 CCTGATGAGGGCTCTTTTCTTGG - Intergenic
986573347 5:9188238-9188260 GTGGCTGATGACTCATTTCCTGG - Intronic
987266527 5:16262059-16262081 CTGGGCTAGGACACTTTTCTGGG - Intergenic
994758069 5:103818880-103818902 CTTTCTGAGGTCTCTTTCCTTGG - Intergenic
998160649 5:139811059-139811081 CTGGCAGAGGTGTCTTTACTGGG + Intronic
998335247 5:141365801-141365823 CTGGCTGAAGACACATTTCAGGG + Exonic
998618741 5:143771307-143771329 TTGGTTGAGGACTTTTTCCTTGG - Intergenic
1003343605 6:5244914-5244936 CAGGCTGAGGGCTGTTTTCCTGG + Intronic
1003541177 6:7019368-7019390 GTGGCTGGGGACTCTAGTCTGGG - Intergenic
1003727893 6:8786731-8786753 CTTGCAGAAAACTCTTTTCTGGG - Intergenic
1005643643 6:27820456-27820478 CTGGCTGAAGACTCTTTTTGAGG - Intergenic
1007086199 6:39147653-39147675 CTGTCTGAAGTCTCTCTTCTAGG - Intergenic
1011842297 6:91516777-91516799 CAGGCTGAGGACACTATTCCTGG + Intergenic
1012969253 6:105709409-105709431 CTGGCTTAGAACCATTTTCTTGG + Intergenic
1013100384 6:106981427-106981449 TGGTCTGAAGACTCTTTTCTAGG - Intergenic
1014168942 6:118256510-118256532 CTGGCAGAGGAGTCTCTTTTGGG + Intronic
1015472595 6:133622615-133622637 ATGGCTGAGGTCTCACTTCTGGG - Intergenic
1015630361 6:135226290-135226312 CTGGCAGAGTAATATTTTCTTGG + Intergenic
1017680369 6:156857735-156857757 CTGTCTGATGACACATTTCTCGG - Intronic
1017899422 6:158706260-158706282 CTGGCTAAGGACCCTGATCTAGG + Intronic
1021949734 7:25762961-25762983 CTAGCAGTGGACTCTATTCTGGG + Intergenic
1021987326 7:26109609-26109631 CTCTCTGATGACACTTTTCTGGG - Intergenic
1022294597 7:29038301-29038323 CTCTCTGAGGTCTCTTTTGTAGG - Intronic
1023010135 7:35918583-35918605 CTGTCTGAAGTCTCCTTTCTGGG - Intergenic
1023830569 7:44036792-44036814 CTTGATGAGGGCGCTTTTCTGGG + Intergenic
1023852161 7:44156608-44156630 CTGGCACAGGGCTCTTATCTGGG + Intronic
1024080690 7:45852996-45853018 CTGTCTGAAGTCTCCTTTCTGGG + Intergenic
1024247148 7:47479308-47479330 CTGGCTGAAGCCTGTTTTCCTGG - Intronic
1025123763 7:56328684-56328706 CTGTCTGAAGTCTCCTTTCTGGG - Intergenic
1025772924 7:64529735-64529757 AAGGCTGAGGAAGCTTTTCTCGG - Intronic
1025848052 7:65217864-65217886 CTGTCTGAAGTCTCCTTTCTGGG - Intergenic
1025898290 7:65723729-65723751 CTGTCTGAAGTCTCCTTTCTGGG - Intergenic
1026113142 7:67474385-67474407 TTGGCTGGGAACTCTTGTCTGGG + Intergenic
1026400754 7:70010440-70010462 CTGGCTGAGGACATTTTTAAAGG + Intronic
1026764802 7:73153958-73153980 CAGGCTGAGAACTCTTTTTCAGG - Intergenic
1026931013 7:74223008-74223030 CAGGCTGAGGATGCTTTGCTCGG - Intronic
1027701553 7:81476213-81476235 AAGGGTGAGGACCCTTTTCTGGG + Intergenic
1028502155 7:91531013-91531035 CTGGTTCTGGACTTTTTTCTTGG - Intergenic
1028731062 7:94148884-94148906 CTTGCTGAGGACCCCTTACTGGG + Intergenic
1029339904 7:99934246-99934268 CAGCCTGAGGACTCCTCTCTCGG - Intergenic
1029709797 7:102293310-102293332 GTGGCTGGGGTCTCTTGTCTGGG + Intronic
1029740898 7:102491106-102491128 CTTGATGAGGGCGCTTTTCTGGG + Intronic
1029758892 7:102590279-102590301 CTTGATGAGGGCGCTTTTCTGGG + Exonic
1029897527 7:104000145-104000167 GTGCCTGTGGCCTCTTTTCTGGG + Intergenic
1030197028 7:106862555-106862577 CTGGCTGGGAACTCTGTTATTGG - Intergenic
1031968400 7:128045291-128045313 ATGGCTTAGAACTCTATTCTGGG - Intronic
1035145001 7:156805964-156805986 CTTGATGAGGACCCTATTCTTGG - Intronic
1037904628 8:22708390-22708412 CTGGGGAAGGACTCTCTTCTGGG + Intergenic
1038048925 8:23790938-23790960 TTTGCTGAGTCCTCTTTTCTAGG + Intergenic
1040675678 8:49746562-49746584 CTTGGTGAGGGCTCTTTTCATGG + Intergenic
1042940147 8:74099241-74099263 ATGGCTGAGGACCGTTTTCAAGG - Intergenic
1043845717 8:85161245-85161267 TTTTCTGAGGCCTCTTTTCTTGG - Intergenic
1043921386 8:85987563-85987585 TTGTTTGAGAACTCTTTTCTAGG - Intronic
1044891193 8:96837722-96837744 CTGCCTGTGGATTCTTCTCTGGG + Intronic
1045189061 8:99865473-99865495 CTGGCGGAGGCCTGTTTTGTTGG - Intronic
1046629039 8:116605101-116605123 CTTGGTGAGGACTCTATTCCTGG - Intergenic
1050836540 9:10087518-10087540 CTGCCTGAGAACACTTTGCTCGG - Intronic
1052891573 9:33705060-33705082 CTGGCTTAGGACGCTTTTCAAGG + Intergenic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1056854259 9:90111698-90111720 CAGGCTGAGGATTCTTTGTTTGG + Intergenic
1056913567 9:90725599-90725621 CTGAAAGAGGACTCCTTTCTGGG - Intergenic
1057928874 9:99176526-99176548 CTGTGTGAGGACTCTCTTCCTGG - Intergenic
1059797625 9:117715917-117715939 CTGGATGAACATTCTTTTCTGGG - Exonic
1060665332 9:125429115-125429137 CTGGCAGAGGCGTCTGTTCTCGG - Intergenic
1061712172 9:132495881-132495903 CTTGGTGAGGGCTCTCTTCTTGG - Intronic
1062716215 9:138011442-138011464 CTGGCTGTGGGCATTTTTCTGGG + Intronic
1062719070 9:138025531-138025553 CTGGCTGAGGACTCTGTCCACGG + Intronic
1186148946 X:6653921-6653943 CTTGGTGAGTACTCTTTTCCTGG - Intergenic
1186481945 X:9902733-9902755 TTGGGTGAGGACTGTGTTCTGGG + Intronic
1188277458 X:28217864-28217886 TTTCCTGAGGCCTCTTTTCTTGG + Intergenic
1188929463 X:36088590-36088612 CTAGGTGAGGCCTCTTTTCCTGG - Intronic
1189570443 X:42290371-42290393 CTTGCAGAGACCTCTTTTCTTGG + Intergenic
1191665723 X:63700650-63700672 CTGGCTGTGTGCTATTTTCTTGG - Intronic
1191667157 X:63715215-63715237 CTGGCAGAGCACTCCTTTTTTGG - Intronic
1192623874 X:72707935-72707957 CTTTCTCAGGACTCCTTTCTTGG - Intronic
1193878379 X:86892310-86892332 TTTCCTGAGGCCTCTTTTCTTGG + Intergenic
1194981489 X:100445571-100445593 CTTGGTGAGGGCTCTCTTCTTGG - Intergenic
1196021604 X:110996734-110996756 CATTCTGAGGCCTCTTTTCTTGG - Intronic
1196415981 X:115471657-115471679 CATTCTGAGGCCTCTTTTCTTGG - Intergenic
1197769749 X:130082502-130082524 CTGGCTCAGGCCCCTTTTCCAGG + Intronic
1197800965 X:130348139-130348161 TCTGCTGAGGTCTCTTTTCTGGG + Intronic
1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG + Intronic
1199696379 X:150345566-150345588 TTGGCTGGGGACTCTTTTTCTGG - Intergenic