ID: 1129742155

View in Genome Browser
Species Human (GRCh38)
Location 15:77994504-77994526
Sequence CACCCCTATGGGAACCCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 2, 1: 0, 2: 2, 3: 5, 4: 74}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129742144_1129742155 17 Left 1129742144 15:77994464-77994486 CCTGCCCTGTCTGGGAATCCTTG 0: 2
1: 0
2: 2
3: 19
4: 213
Right 1129742155 15:77994504-77994526 CACCCCTATGGGAACCCCTTTGG 0: 2
1: 0
2: 2
3: 5
4: 74
1129742143_1129742155 23 Left 1129742143 15:77994458-77994480 CCTTGGCCTGCCCTGTCTGGGAA 0: 2
1: 0
2: 0
3: 48
4: 431
Right 1129742155 15:77994504-77994526 CACCCCTATGGGAACCCCTTTGG 0: 2
1: 0
2: 2
3: 5
4: 74
1129742145_1129742155 13 Left 1129742145 15:77994468-77994490 CCCTGTCTGGGAATCCTTGCTGG 0: 1
1: 3
2: 0
3: 16
4: 176
Right 1129742155 15:77994504-77994526 CACCCCTATGGGAACCCCTTTGG 0: 2
1: 0
2: 2
3: 5
4: 74
1129742148_1129742155 -1 Left 1129742148 15:77994482-77994504 CCTTGCTGGAGCCACCCCGAAAC 0: 1
1: 1
2: 0
3: 6
4: 91
Right 1129742155 15:77994504-77994526 CACCCCTATGGGAACCCCTTTGG 0: 2
1: 0
2: 2
3: 5
4: 74
1129742147_1129742155 12 Left 1129742147 15:77994469-77994491 CCTGTCTGGGAATCCTTGCTGGA 0: 1
1: 1
2: 2
3: 10
4: 172
Right 1129742155 15:77994504-77994526 CACCCCTATGGGAACCCCTTTGG 0: 2
1: 0
2: 2
3: 5
4: 74
1129742140_1129742155 28 Left 1129742140 15:77994453-77994475 CCAGGCCTTGGCCTGCCCTGTCT 0: 2
1: 1
2: 5
3: 134
4: 882
Right 1129742155 15:77994504-77994526 CACCCCTATGGGAACCCCTTTGG 0: 2
1: 0
2: 2
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129742155 Original CRISPR CACCCCTATGGGAACCCCTT TGG Intronic
901173942 1:7284984-7285006 CAGCCCTCTGGGAAACCCATTGG + Intronic
901853357 1:12029644-12029666 AATCCCTCTGGGAAGCCCTTCGG - Intronic
902849448 1:19142041-19142063 CACCTTTATGGAAATCCCTTTGG - Intronic
904970834 1:34418345-34418367 GTCCCCTCTGGGAACCCCCTGGG + Intergenic
905637367 1:39563725-39563747 CACAGCTGTGGGAACGCCTTAGG + Exonic
910810076 1:91226959-91226981 CAGCCCAATGTGAACCCATTAGG + Intergenic
914152740 1:145058074-145058096 CAGCCCTATGGGAAACGCATAGG + Intronic
915458530 1:156055459-156055481 CGCCCCCTTGGGATCCCCTTTGG - Intronic
918379664 1:183941304-183941326 CTCCCCAAAAGGAACCCCTTAGG - Intronic
920343622 1:205291893-205291915 AACCCCTGGGGGAACCCCTGGGG - Intergenic
921218785 1:212958605-212958627 CACCCCTCTGGGGATCTCTTAGG + Intronic
1070789665 10:79181665-79181687 CACCCCTTTGTGACCCCCTCTGG + Intronic
1070974496 10:80595498-80595520 GACCCCTCTGTGAAACCCTTTGG + Intronic
1074188266 10:111115193-111115215 CAGCACTAGGGGAACCCCGTCGG - Intergenic
1076576717 10:131474405-131474427 CACCCCTCTTGGAGCCCCCTGGG - Intergenic
1077479773 11:2808102-2808124 CACCACTGTGGGCACCACTTGGG + Intronic
1083594347 11:63911888-63911910 CACCCTGATTGGAACCCCTCTGG - Exonic
1086455281 11:86954761-86954783 CACCCCTGGCGGGACCCCTTGGG - Intronic
1092070849 12:5630119-5630141 CAGCCCTGTGGGAAACACTTGGG + Intronic
1096000130 12:48122497-48122519 CACCCCAATTGGAACCTATTTGG - Intronic
1096475574 12:51907192-51907214 GACCCCTATGGGACCCCCACAGG + Intronic
1099364728 12:81754152-81754174 CACTGCTTTGGGACCCCCTTTGG + Exonic
1116868399 14:50049755-50049777 CAGCTCTATCAGAACCCCTTGGG - Intergenic
1118739219 14:68726700-68726722 CACCCATATTGAATCCCCTTGGG + Intronic
1119232649 14:72993104-72993126 CACCCCAATGAGAAGCCCTTGGG + Intronic
1119592660 14:75904352-75904374 ATACCCTATGAGAACCCCTTTGG + Intronic
1125478920 15:40066852-40066874 AACCCCTTTGGGCACCCCTGGGG - Intergenic
1128465382 15:67906568-67906590 CACCTCTATGGAAACCACTAGGG + Intergenic
1129742155 15:77994504-77994526 CACCCCTATGGGAACCCCTTTGG + Intronic
1129843329 15:78756976-78756998 CACCCCTATGGGAACCCCTTTGG - Intergenic
1141616217 16:85211171-85211193 CACCCCTCTGGGAGTTCCTTAGG + Intergenic
1144115574 17:12086599-12086621 CAGCCATATTGGAAGCCCTTGGG + Intronic
1148644190 17:49210096-49210118 CACCCCTCTGGCAACCTCTCTGG + Intronic
1149585087 17:57781061-57781083 CATCTATATGGGAAACCCTTTGG + Intergenic
1149869538 17:60169448-60169470 CACCCAGATGGTACCCCCTTGGG - Intronic
1153053861 18:926367-926389 CCCCCCTATTGTCACCCCTTTGG - Intergenic
1158383232 18:56959200-56959222 CCCCCAAATGGGAACCCCTTTGG + Intronic
1161026561 19:2039894-2039916 CACCCCTCAGGGGACCCCTGGGG + Intronic
1161615734 19:5269233-5269255 CACGCTTATGGGGACCCCTGCGG - Intronic
1163861423 19:19744893-19744915 AGCCCCTTTGGGAACCCGTTGGG + Intergenic
931248924 2:60513456-60513478 CCACCCCATGGGAACCCCTTTGG + Intronic
937713239 2:125002251-125002273 CACCCATATGTGAAACCCTCTGG + Intergenic
943167070 2:184342953-184342975 CTCTCCTATAGGAAACCCTTTGG + Intergenic
946910703 2:224457724-224457746 CACCCATATGGGGACCCAGTGGG - Intergenic
1169485971 20:6033037-6033059 AACCCTTATAGGAAGCCCTTAGG + Intronic
1170001537 20:11620204-11620226 CTCCCCAGTGGGACCCCCTTTGG - Intergenic
1171785302 20:29458474-29458496 CACCCCTCTGCGAGGCCCTTGGG - Intergenic
1173813139 20:45968420-45968442 CACCCCCATGGGCCCCACTTTGG + Intronic
1174058135 20:47813589-47813611 TACCCCCATGGTAACCCCTATGG - Intergenic
1176136083 20:63522575-63522597 CACCCCTATGGGAGGCCCTTGGG - Intergenic
950287015 3:11753014-11753036 CAGCACTATCTGAACCCCTTCGG - Intergenic
955066577 3:55538361-55538383 TACCCCTGGTGGAACCCCTTTGG - Intronic
956483115 3:69692934-69692956 CATCCCTTTGGCAACCTCTTAGG + Intergenic
968648285 4:1750490-1750512 ACTCCCTCTGGGAACCCCTTGGG - Intergenic
969115524 4:4868539-4868561 CCCTCCTCTGGGACCCCCTTCGG + Intergenic
974897044 4:67952579-67952601 CACCATTATGGGAACCTCTGTGG - Intronic
977669566 4:99680312-99680334 CACCAGCATGGGGACCCCTTGGG - Intergenic
983918819 4:173322438-173322460 CAACCCTATGGGACAGCCTTGGG - Exonic
988521003 5:31945648-31945670 CTTCCCTATGGGAACCCCCTAGG + Intronic
992842610 5:80711221-80711243 CCCCACTATGGGAACTCCATGGG - Intronic
993090810 5:83424051-83424073 CAACACTAGGTGAACCCCTTGGG - Intergenic
996443347 5:123515304-123515326 CATCCTTTTGGGAAGCCCTTTGG - Intronic
997017099 5:129948758-129948780 CACCCCTATGGAAAACCATATGG - Intronic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1003651138 6:7961492-7961514 AACCCCCATGGGAAACCCTAAGG + Intronic
1003675614 6:8201888-8201910 CACCCAAATGGGAATCCCTTAGG - Intergenic
1007088437 6:39166992-39167014 GATCCCTAAGGGAACCCCCTAGG + Intergenic
1007408769 6:41649621-41649643 CAGCCTCAGGGGAACCCCTTGGG + Exonic
1013021564 6:106226028-106226050 CTCACCTATGGGAAACCCTGAGG + Intronic
1016501234 6:144723059-144723081 CACCCATGAGGTAACCCCTTAGG - Intronic
1024639176 7:51316236-51316258 CACCCCTACGGCAAACACTTGGG + Intronic
1025079779 7:55971436-55971458 CACCCAAAGGGGAATCCCTTTGG + Intronic
1032197218 7:129796398-129796420 CACCCTCAGGGGACCCCCTTTGG - Intergenic
1034986186 7:155516855-155516877 CAGCCCTCCGGGAAGCCCTTAGG + Intronic
1035733091 8:1866188-1866210 CACCCCTTTGAGGACCTCTTAGG - Intronic
1043827049 8:84941883-84941905 CACTCCTATTGGAACCCTTAAGG + Intergenic
1048792053 8:138113158-138113180 CACCCCTCCGGGAATCCCATGGG + Intergenic
1049236106 8:141513184-141513206 CACCCCCCTGAGAACCCCTCAGG - Intergenic
1055711085 9:79062722-79062744 GACCCCTGTGGCAACCCCCTAGG - Intergenic
1062157437 9:135060895-135060917 GGCCCATATGGGAACCCCATGGG - Intergenic
1203446085 Un_GL000219v1:57705-57727 CACCCCTCTGCGAGGCCCTTGGG - Intergenic
1192002607 X:67170553-67170575 CACCCCTATGGAAAGCAGTTTGG + Intergenic
1195732305 X:107979813-107979835 CACCCCTAAGGGAATCCCTTAGG - Intergenic