ID: 1129743173

View in Genome Browser
Species Human (GRCh38)
Location 15:78000095-78000117
Sequence CGCTGTTATCAAGACTGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 72}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129743173_1129743185 25 Left 1129743173 15:78000095-78000117 CCCTTGCAGTCTTGATAACAGCG 0: 1
1: 1
2: 0
3: 6
4: 72
Right 1129743185 15:78000143-78000165 CCTTAAAGCACCTGTTGGTGTGG 0: 1
1: 1
2: 0
3: 18
4: 106
1129743173_1129743183 20 Left 1129743173 15:78000095-78000117 CCCTTGCAGTCTTGATAACAGCG 0: 1
1: 1
2: 0
3: 6
4: 72
Right 1129743183 15:78000138-78000160 GCACTCCTTAAAGCACCTGTTGG 0: 1
1: 1
2: 0
3: 34
4: 1226
1129743173_1129743178 -2 Left 1129743173 15:78000095-78000117 CCCTTGCAGTCTTGATAACAGCG 0: 1
1: 1
2: 0
3: 6
4: 72
Right 1129743178 15:78000116-78000138 CGGGGAGCCTGCCGCCGCCTTGG 0: 1
1: 1
2: 0
3: 11
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129743173 Original CRISPR CGCTGTTATCAAGACTGCAA GGG (reversed) Intronic
910086730 1:83411739-83411761 GGCTGTAATCAAGTCTGTAAAGG + Intergenic
911334024 1:96559797-96559819 AGCTATTATAAAGACTACAAAGG - Intergenic
1069520110 10:69112221-69112243 AGCTGGTATCAAGACTACAATGG - Intergenic
1072508223 10:96091297-96091319 TGCTGTTATAATGACGGCAAAGG + Intergenic
1075914735 10:126157571-126157593 CGCTGTTAAGTAGACTGCAGCGG - Intronic
1078633452 11:13027711-13027733 CACTGTTATAAAAACTGTAATGG - Intergenic
1080236833 11:30079672-30079694 CACTGTTATAAGAACTGCAAGGG - Intergenic
1091090421 11:132765780-132765802 AGCTGTTTTCAATACTGCTAGGG - Intronic
1093907872 12:24713751-24713773 CGGTGTTATGAATACAGCAAAGG - Intergenic
1097104325 12:56612238-56612260 AGCTGTTATCTAGAATCCAAAGG + Exonic
1100852149 12:98723743-98723765 CTCTGCTGACAAGACTGCAAAGG + Exonic
1102262622 12:111453705-111453727 CGCTGTTGTCGAGACTGGAATGG + Exonic
1106508593 13:30393266-30393288 CACTGTTATAAACTCTGCAATGG + Intergenic
1107469850 13:40681721-40681743 TGCTGTTATCAAGACTAGGAAGG - Intergenic
1107989369 13:45803782-45803804 TCCTGTTATCAAGACTGCTAAGG + Intronic
1111406736 13:87816548-87816570 TGCTGTGATAAACACTGCAATGG - Intergenic
1111700675 13:91683962-91683984 AGCTGTTATCAAGGTTGCTAAGG + Intronic
1118609653 14:67530117-67530139 CTCTGTTTACAAGATTGCAATGG - Intronic
1119141251 14:72269308-72269330 CGCTTTTATCTGGAATGCAATGG - Intronic
1122557141 14:102587118-102587140 CTCTGTTACCCAGGCTGCAATGG + Intergenic
1129743173 15:78000095-78000117 CGCTGTTATCAAGACTGCAAGGG - Intronic
1129842308 15:78751345-78751367 CGCTGTTATCAAGACTGCAGGGG + Intergenic
1138157823 16:54722266-54722288 AGCTGTGATAAACACTGCAAAGG + Intergenic
1143575547 17:7790744-7790766 CTCTGTTACCAAGGCTGGAATGG + Intronic
1151095919 17:71498108-71498130 CTCTGTCATCAAGGCTGGAATGG + Intergenic
1153508979 18:5832217-5832239 TGTTGTTATGAAGAGTGCAAAGG + Intergenic
1156697082 18:39780101-39780123 AGCTGTTAAGGAGACTGCAAAGG - Intergenic
1161626079 19:5327636-5327658 CTCTGTTACCCAGAGTGCAATGG + Intronic
1161982649 19:7637787-7637809 CACTGTTATCAAGACGGCCAGGG - Intronic
1163119045 19:15205219-15205241 CTCTGTTATCCAGACTGGAGTGG - Intergenic
1165666345 19:37632421-37632443 TTCTGTGATCAAAACTGCAAAGG + Exonic
926094016 2:10069192-10069214 CACTGTTATAATGGCTGCAAAGG + Intronic
929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG + Intronic
930532097 2:52601629-52601651 CACTGTTATCAAAACACCAAGGG + Intergenic
931209199 2:60176618-60176640 GGCTGGTAGCAAGAGTGCAATGG + Intergenic
931419607 2:62114391-62114413 TGCTCTTATCAAGAGGGCAAGGG + Intronic
936024053 2:109017735-109017757 TGCTGTTATTAAGATTCCAAGGG - Intergenic
940329551 2:152459347-152459369 TGCTTTTGTTAAGACTGCAATGG + Intronic
943796828 2:192006840-192006862 CGCTGTTGTCAAAAATGCTACGG + Intronic
1183043656 22:35202511-35202533 AGCTGTAACCCAGACTGCAAAGG + Intergenic
949306793 3:2651170-2651192 AGCTGTTAAATAGACTGCAATGG - Intronic
963765410 3:149329929-149329951 TTCTGTTATCTTGACTGCAATGG + Intronic
964079794 3:152740325-152740347 TGCTGTTATCCAGACTTTAATGG + Intergenic
966127219 3:176593453-176593475 AGCTGTCAACAAGACTGCATGGG - Intergenic
970384574 4:15543178-15543200 TCCTGTTATCAATACAGCAAAGG - Intronic
972167021 4:36299367-36299389 TGCTGTTCTGAAGACTGCAGTGG + Intronic
978759463 4:112340596-112340618 CACTGTTATTAAGATTACAAAGG + Intronic
980285108 4:130770633-130770655 CGCTGTGATGAAGGGTGCAAAGG - Intergenic
989027762 5:37086884-37086906 CGATGTGACCAACACTGCAAAGG + Intergenic
992102153 5:73418429-73418451 CACTGATACCAAGACAGCAAAGG + Intergenic
997120498 5:131168089-131168111 CCCTGTTGCCAAGGCTGCAATGG - Intronic
999980304 5:156951609-156951631 TGCTGTTGTGAAGACGGCAATGG + Exonic
1000994191 5:167942451-167942473 CAATGTTTTCAAGACTGAAAAGG + Intronic
1004062163 6:12208331-12208353 TGCTGTCATCAAGGTTGCAAGGG - Intergenic
1010420386 6:75667580-75667602 TGCTGTTGTCAAGAATCCAAGGG + Intronic
1012612933 6:101237647-101237669 CTCTGTTATGAGGACTGCACAGG - Intergenic
1014383580 6:120774598-120774620 CACTGATATCAAATCTGCAAGGG - Intergenic
1024779641 7:52832744-52832766 CTCTGTGCTCAAGACTGCCAGGG + Intergenic
1030136418 7:106255513-106255535 CTTTGTTTTCAACACTGCAAAGG + Intronic
1032868563 7:135954967-135954989 CACTGGTATTAAGAGTGCAAGGG - Intronic
1033821796 7:145143280-145143302 AGCTGCTTTCAAAACTGCAATGG - Intergenic
1033946505 7:146725310-146725332 CACTGTTATAATGTCTGCAAAGG - Intronic
1037753066 8:21695257-21695279 CTCTGTTATCATCACTGTAATGG + Intronic
1038642833 8:29341293-29341315 CACTGTCATGAAGACCGCAAAGG - Intronic
1039114606 8:34078648-34078670 GGCTGCTATGAAGACTGCAAAGG + Intergenic
1045391339 8:101718081-101718103 GGCTCTTAAGAAGACTGCAAAGG - Intronic
1046813836 8:118562316-118562338 CACTGGCATCAAGACTGCCAAGG + Intronic
1053130405 9:35611343-35611365 CACTGTGATCAAGACAGCAGTGG - Intronic
1053489773 9:38489587-38489609 CCCTGATGTCAAGCCTGCAAGGG - Intergenic
1053781078 9:41607774-41607796 AGCTGTTAACCAGACTGAAAAGG - Intergenic
1054169024 9:61817927-61817949 AGCTGTTAACCAGACTGAAAAGG - Intergenic
1054668508 9:67762889-67762911 AGCTGTTAACCAGACTGAAAAGG + Intergenic
1057361475 9:94377408-94377430 TGCTGTCATCCAGGCTGCAATGG + Intronic
1057442711 9:95093522-95093544 AGTTGTTATCAAGTATGCAAAGG - Intergenic
1057661886 9:97010762-97010784 TGCTGTCATCCAGGCTGCAATGG - Intronic
1057670109 9:97078896-97078918 CCCTGATGTCAAGCCTGCAACGG - Intergenic
1059578853 9:115521787-115521809 CGTAGTTATGAAGACTGCTACGG + Intergenic
1061041466 9:128143237-128143259 CGCTGTTAGCTAGGCTGCAATGG - Intergenic
1061855424 9:133439470-133439492 CCCAGTTAGCTAGACTGCAAAGG + Intronic
1201119573 Y:10862636-10862658 CTCTGTCACCAAGACTGGAATGG + Intergenic