ID: 1129744374

View in Genome Browser
Species Human (GRCh38)
Location 15:78007914-78007936
Sequence GGCCAGCGGGAGGTGCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 544
Summary {0: 1, 1: 2, 2: 7, 3: 58, 4: 476}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129744374_1129744390 25 Left 1129744374 15:78007914-78007936 CCTGCCAGCACCTCCCGCTGGCC 0: 1
1: 2
2: 7
3: 58
4: 476
Right 1129744390 15:78007962-78007984 AGTGGTGCAGGAGAAGGGCAAGG 0: 1
1: 1
2: 3
3: 59
4: 589
1129744374_1129744386 13 Left 1129744374 15:78007914-78007936 CCTGCCAGCACCTCCCGCTGGCC 0: 1
1: 2
2: 7
3: 58
4: 476
Right 1129744386 15:78007950-78007972 CTTGCAACACCAAGTGGTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 96
1129744374_1129744388 20 Left 1129744374 15:78007914-78007936 CCTGCCAGCACCTCCCGCTGGCC 0: 1
1: 2
2: 7
3: 58
4: 476
Right 1129744388 15:78007957-78007979 CACCAAGTGGTGCAGGAGAAGGG 0: 1
1: 0
2: 1
3: 20
4: 244
1129744374_1129744391 30 Left 1129744374 15:78007914-78007936 CCTGCCAGCACCTCCCGCTGGCC 0: 1
1: 2
2: 7
3: 58
4: 476
Right 1129744391 15:78007967-78007989 TGCAGGAGAAGGGCAAGGAGAGG 0: 1
1: 0
2: 13
3: 99
4: 1063
1129744374_1129744384 7 Left 1129744374 15:78007914-78007936 CCTGCCAGCACCTCCCGCTGGCC 0: 1
1: 2
2: 7
3: 58
4: 476
Right 1129744384 15:78007944-78007966 CCAGGCCTTGCAACACCAAGTGG 0: 1
1: 0
2: 0
3: 13
4: 140
1129744374_1129744387 19 Left 1129744374 15:78007914-78007936 CCTGCCAGCACCTCCCGCTGGCC 0: 1
1: 2
2: 7
3: 58
4: 476
Right 1129744387 15:78007956-78007978 ACACCAAGTGGTGCAGGAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129744374 Original CRISPR GGCCAGCGGGAGGTGCTGGC AGG (reversed) Intronic
900430222 1:2597852-2597874 GGCCAGAGGCAGGAGCAGGCAGG - Intronic
900857783 1:5199914-5199936 GGCCAACGGGAAGTACTTGCAGG - Intergenic
901056432 1:6450569-6450591 GGGCAGGGGCAGGGGCTGGCAGG + Intronic
901128946 1:6950144-6950166 GGGCAGGGGATGGTGCTGGCTGG + Intronic
901407846 1:9061784-9061806 GCCCAGCTGGTGGAGCTGGCTGG + Intronic
901448962 1:9324698-9324720 GGGCTCCGGGAGATGCTGGCTGG - Intronic
901510443 1:9715806-9715828 GGTCAGCGGGTGGGGCAGGCAGG - Intronic
901882508 1:12202439-12202461 GGCCAGCTGGGGGTGGTAGCAGG - Intronic
902360181 1:15938069-15938091 GGCCAGGGAGATGGGCTGGCAGG - Intronic
902477914 1:16697916-16697938 GGGCAGGGGCAGGGGCTGGCAGG - Intergenic
902850038 1:19148058-19148080 GGACACTGGCAGGTGCTGGCAGG + Exonic
902923156 1:19679256-19679278 GGGCAGCGGGGGGTCCTGGGTGG - Exonic
903302051 1:22386155-22386177 GGCCACAGGGAGGCGATGGCAGG - Intergenic
904035888 1:27558289-27558311 GGCCAAGGTGAGGTGCTGGGAGG - Exonic
904253551 1:29240649-29240671 AGCCTGGGGGAGGGGCTGGCAGG - Intronic
904372414 1:30058222-30058244 AGCCAATGGGAGGTGCTGCCAGG + Intergenic
904591414 1:31617622-31617644 GGCCGGCGGGAGGGGCAGGGCGG - Intergenic
905515635 1:38559843-38559865 GGCGAGCGGGAGGGGCGGGGCGG + Intergenic
905797586 1:40824227-40824249 GGGCAGAAGGAGGTGCTGCCCGG - Exonic
906670480 1:47650736-47650758 GAGCTGGGGGAGGTGCTGGCTGG - Intergenic
906711622 1:47934483-47934505 TGCCAGCGGGAGGGGCAGGCGGG + Intronic
910206682 1:84755295-84755317 GGCCAGCGGAAGGTGCTGCGGGG - Intergenic
911088656 1:94000708-94000730 GGGCAGAGGCAGGTGGTGGCTGG - Intronic
912451109 1:109768332-109768354 CACCAGCAAGAGGTGCTGGCTGG - Intronic
913961253 1:143339579-143339601 AGTCAGTGGGAGGGGCTGGCGGG + Intergenic
914055606 1:144165152-144165174 AGTCAGTGGGAGGGGCTGGCGGG + Intergenic
914123540 1:144801210-144801232 AGTCAGTGGGAGGGGCTGGCGGG - Intergenic
915065850 1:153223231-153223253 GGCCAGCAGGTGGTGCTGTTGGG - Intergenic
915066529 1:153229446-153229468 GGCCAGCAGGTGGTGCTGTTGGG - Intergenic
915310507 1:155003878-155003900 GGCCAGAGCGAGGTGGGGGCGGG + Intronic
915507936 1:156369120-156369142 GGCCTGCGGCAGGTGAGGGCGGG + Intergenic
915733092 1:158067840-158067862 GGCTGGCTGGAGGGGCTGGCTGG - Intronic
915733098 1:158067853-158067875 GGCCAGCTGCAGCGGCTGGCTGG - Intronic
915953265 1:160204465-160204487 GGCCTGCTGGAGTTCCTGGCAGG + Intergenic
917220995 1:172728123-172728145 GGCCAGTAGGTGGTGCTTGCAGG - Intergenic
918067833 1:181113411-181113433 GTCCATCGGGAGGTGCAGGAGGG - Intergenic
918071962 1:181139749-181139771 GGCCAGAGGGAGGATGTGGCTGG + Intergenic
918313605 1:183304477-183304499 GGCCAGCAGAAGGTGCGGGCTGG + Intronic
919726948 1:200890971-200890993 GGGCAGCAGGAGGCGCTCGCCGG + Intergenic
920859918 1:209697402-209697424 GGCCAGCAGGAGCTGCTTCCAGG - Intronic
921783082 1:219192079-219192101 GACCAGTGGGTGGTGCTGGAAGG - Intronic
921801779 1:219410694-219410716 GGCCAGCTGGAGTTCCTGGTGGG + Intergenic
922480547 1:225937633-225937655 GGCCTCCGGGGGCTGCTGGCAGG + Exonic
923032640 1:230262396-230262418 GTCCAGCTCGAGGTGCTGGTGGG + Intronic
923698730 1:236280988-236281010 GGCAGTCGTGAGGTGCTGGCTGG - Intronic
924740341 1:246791103-246791125 GGCCAGCGGGATGGGGTGGTGGG + Intergenic
1065895867 10:30162876-30162898 GGGCTGCGTGAGGTGCTTGCCGG + Intergenic
1066034574 10:31468351-31468373 GGCCAGTAGGTGATGCTGGCAGG - Intronic
1066597063 10:37062510-37062532 GGCCAGCGGGAGTTCCAGGTGGG + Intergenic
1066638898 10:37535802-37535824 GCCCAGCAGTAGGTGGTGGCTGG + Intergenic
1067029705 10:42871978-42872000 AGTCAGTGGGAGGGGCTGGCGGG + Intergenic
1067216957 10:44311142-44311164 GGGCAGCGGGTGATGCAGGCAGG - Intergenic
1068053630 10:51983237-51983259 GGACAGAGTGAGGTGCTGGTGGG + Intronic
1068648270 10:59493233-59493255 GGCCAGCAGGTGGTGCATGCAGG - Intergenic
1069717286 10:70529394-70529416 GGCCAGAGGGAGGTGAGGGAGGG - Intronic
1070955517 10:80460940-80460962 GGGCAGAGGGAGGTGCTGTGGGG + Intronic
1071521623 10:86334880-86334902 GGCCAGCCAGCGGTGCTGGCAGG + Intronic
1073242096 10:102065692-102065714 GTCCAGCGGGGAGGGCTGGCCGG - Exonic
1073299338 10:102461461-102461483 GGCCAGCGGCCGGGGCTCGCGGG + Intronic
1073481297 10:103787646-103787668 TGCCCTCGGGAGGTGCTGCCGGG + Intronic
1073542861 10:104327087-104327109 GGTCAGCGAGGGGAGCTGGCTGG - Intronic
1073565067 10:104527972-104527994 GTCCAATGGGAGGGGCTGGCAGG + Intergenic
1073965105 10:108979613-108979635 GGCAAGCGGGAGGTTGAGGCAGG - Intergenic
1075545634 10:123352325-123352347 GGCCAGAGGGAGGCCCAGGCAGG - Intergenic
1076674327 10:132140371-132140393 GGGCAGCGGGAGGAGGCGGCGGG + Intronic
1076809551 10:132879504-132879526 GGCCAGCAGGATGTGCACGCGGG + Exonic
1076889690 10:133277428-133277450 GGCCAGCGTCAGCTGCTGTCTGG - Intergenic
1077068180 11:654114-654136 GGACAGAGGCAGGTGCAGGCAGG + Intronic
1077104887 11:837887-837909 GGCCAGTGGGAGGTGCCCCCTGG + Intronic
1077160481 11:1110299-1110321 GCCCGGCGGGAGGTGCCGGTGGG - Intergenic
1077536368 11:3126673-3126695 AGTCAGCCGGAGGTGGTGGCAGG + Intronic
1077853612 11:6099800-6099822 GGCCAGGGGGAGGCACTGGTGGG - Intergenic
1078626422 11:12962749-12962771 GGCCAGTGGAAGGTTCTGGTAGG + Intergenic
1081420870 11:42873961-42873983 GGCCAGCTGGAGTTGCGGGTGGG + Intergenic
1081733022 11:45384781-45384803 AGCCAGTGAGAGATGCTGGCTGG - Intergenic
1081876873 11:46414535-46414557 TGATAGGGGGAGGTGCTGGCGGG - Intronic
1081994571 11:47355184-47355206 GGCCAGCGGGGAGGCCTGGCGGG + Exonic
1082785124 11:57312634-57312656 AGCCAGCGGGAGCTGCTTTCAGG + Exonic
1082833873 11:57638527-57638549 GGCCCGGGAGAGGGGCTGGCGGG + Intergenic
1083171168 11:60924733-60924755 GGTCAGCGGGAGGGGAGGGCCGG + Exonic
1083274157 11:61587552-61587574 GGGCGGCGAGTGGTGCTGGCTGG - Intergenic
1083858226 11:65404492-65404514 GGGAGGCGGGTGGTGCTGGCTGG - Intronic
1083891038 11:65595844-65595866 GGCCAGGAGGAGGTGCTGTGTGG + Exonic
1083994941 11:66267194-66267216 GGCCAGCAGGAGGTGCCGGCTGG + Exonic
1084008134 11:66333889-66333911 GGGCAGGGTGAGGTGGTGGCAGG + Intronic
1084084828 11:66850162-66850184 GGCCAGTGGCAGGTGCATGCAGG + Intronic
1084422509 11:69067379-69067401 GGCCACAGGGAGATGCAGGCTGG + Intronic
1084660044 11:70541393-70541415 GGACAGCTGGCTGTGCTGGCTGG + Intronic
1085320188 11:75569210-75569232 AGCCAGGGGGAGGTGCTTGGGGG + Intronic
1085731425 11:79002222-79002244 GGCAGGAGTGAGGTGCTGGCAGG - Intronic
1086569658 11:88267072-88267094 GGCCTGCAGCAGGTGCTGCCTGG - Intergenic
1087263584 11:96037756-96037778 GCCCAGCGAGAGCTCCTGGCTGG - Intronic
1088262873 11:107960884-107960906 AGCCAATGGGAGGCGCTGGCTGG - Intronic
1088604190 11:111512736-111512758 GGCCAGCGGGCGGCGCTGCCGGG - Intergenic
1088806506 11:113358144-113358166 GGCAAGGGGAAGGTGCTGGTAGG + Intronic
1088868949 11:113875408-113875430 GGCGAGCGGGAGCTGGGGGCGGG - Intronic
1088884326 11:113995072-113995094 GGCAAGAGTGAGGTGCTGCCCGG + Intergenic
1089207112 11:116773103-116773125 GGCCACCGGGACGCGCTCGCAGG + Intergenic
1089411540 11:118247131-118247153 GGCCAACGGGAGGCATTGGCAGG - Intronic
1089461886 11:118658559-118658581 GGCCCGGGGGAGGAGCTGACTGG - Intronic
1090381140 11:126328505-126328527 GGGAGGCGGGAGGGGCTGGCTGG + Intronic
1090407581 11:126486347-126486369 GGCCAGTGTGTGGTGCTGGGTGG + Intronic
1090605626 11:128420527-128420549 GGCTAGGGGGAGTTGCTGTCAGG + Intergenic
1091215048 11:133895832-133895854 GGCCAGCAGGACTTGCTGGCAGG + Intergenic
1091309664 11:134563340-134563362 GGGCAGTGGGAGGGGATGGCAGG + Intergenic
1092168012 12:6354938-6354960 GGCCAGTAGGAGGGGCTGGCAGG - Intronic
1092471743 12:8787309-8787331 GGCCAGCTGGAGTTCCGGGCGGG + Intergenic
1092472936 12:8794766-8794788 GGCCAGCTGGAGTTCCGGGCGGG + Intergenic
1094405380 12:30110766-30110788 GGCCAGCGGGAGTTCCGGGTGGG - Intergenic
1096111399 12:49031349-49031371 TGCCAGCAGGAGGTGGTTGCTGG + Exonic
1096498334 12:52051285-52051307 GGCCAGGGGGAGGTGCGGCCCGG - Intronic
1096695334 12:53345045-53345067 GGGCAGCGGGGGGCGCTGGCTGG - Intronic
1096975263 12:55696239-55696261 GCCCAGGGGGAGGAGCTGGGAGG - Intronic
1097185202 12:57192979-57193001 GGCGGGGGGGAGGGGCTGGCGGG + Intronic
1099559643 12:84155439-84155461 GGCCAGCTGGAGTTGCAGGTGGG - Intergenic
1100166645 12:91924228-91924250 GGGCTGCGGGTGGTGCTTGCGGG - Intergenic
1100186491 12:92145387-92145409 AGCCTGCAGGAGCTGCTGGCAGG - Exonic
1101817125 12:108153773-108153795 GGCCAACGGGAGGCCCTGGCAGG - Intronic
1101834844 12:108287997-108288019 GGCAAAAGGGAGGTGATGGCAGG + Intergenic
1101837983 12:108308452-108308474 GGCCAGCGAGAGGTCCGGGCGGG - Intronic
1102387262 12:112520207-112520229 GGCCAGCGCGAGTTCCTGGTGGG - Intergenic
1102638753 12:114347674-114347696 GGACAGAGGGAGATGGTGGCTGG - Intergenic
1102949991 12:117025080-117025102 GGCCAGGTAGAGGTGGTGGCAGG - Intronic
1103493869 12:121345638-121345660 GGCCAATGGGAGGCACTGGCAGG - Intronic
1103744177 12:123110994-123111016 GCCCAGCTGGAGGGGCTTGCTGG - Intronic
1104549129 12:129739750-129739772 AGGCAGTGGGAGGCGCTGGCAGG + Intronic
1105725745 13:23160432-23160454 GGACTCCGGGCGGTGCTGGCCGG - Intergenic
1105874273 13:24539681-24539703 GGGCTGCTGCAGGTGCTGGCCGG - Intergenic
1108751490 13:53452437-53452459 GAGCAGGGGGTGGTGCTGGCTGG + Intergenic
1110751422 13:79119938-79119960 GGCCAGCGGGAGTTCCAGGTGGG - Intergenic
1111692033 13:91576786-91576808 GGCCAGCAGGAGGCGATGACAGG - Intronic
1112271816 13:97976225-97976247 GGACAGCGGGAGGAGCCGGCCGG - Intronic
1113492836 13:110705973-110705995 GGCGAGCGGGGGGCGCGGGCGGG - Exonic
1113765897 13:112881130-112881152 GGGCAGCGGCGGATGCTGGCAGG - Intronic
1117082568 14:52166789-52166811 GGCCAGCGTGAGGTCCAGGTGGG + Intergenic
1118215396 14:63803581-63803603 GGCCAGCTGGAGTTCCGGGCGGG - Intergenic
1118306306 14:64658221-64658243 GGCCAGCGCGAGTTCCTGGTGGG + Intergenic
1119259995 14:73232339-73232361 TGCCGGCTGGAGCTGCTGGCTGG + Intergenic
1120142181 14:80941555-80941577 GGCAAGGGGGAGGTGGGGGCAGG + Intronic
1121413694 14:93764326-93764348 GTCCTGGAGGAGGTGCTGGCTGG - Intronic
1121415167 14:93774334-93774356 GGGCAGCAGCAGGTGCTGTCTGG + Intronic
1121613158 14:95294777-95294799 GGCCAATGGGAGGCGCTGGCAGG + Intronic
1121702853 14:95969030-95969052 GGCCAGAGGGAGGGGGTGGTGGG - Intergenic
1122242036 14:100375615-100375637 GGCCAGCGGGGGGTGAGGGGTGG - Intronic
1122372375 14:101235730-101235752 GGCCACCAGGAGCTGGTGGCAGG - Intergenic
1122386525 14:101351973-101351995 GGCCAGCAGCAGGTGGGGGCTGG + Intergenic
1122774312 14:104110512-104110534 GGCCAGCCTGAGCTGCTGGCTGG + Intronic
1122793065 14:104192575-104192597 GGCCAGCTGGAGCAGCTGGGTGG + Intergenic
1122873277 14:104651105-104651127 GGGGATGGGGAGGTGCTGGCAGG - Intergenic
1122909589 14:104820879-104820901 CGCCAGTGGGAGCTGCTGGCAGG - Intergenic
1122940056 14:104977222-104977244 GGCCAGGGGGTTGGGCTGGCCGG - Intronic
1123025650 14:105422455-105422477 GGCCTGTGGGAGATGCCGGCAGG + Intronic
1123206390 14:106717693-106717715 GGCCAGTAGGTGGTGCTCGCAGG - Intergenic
1123211473 14:106765102-106765124 GGCCAGTAGGTGGTGCTCGCAGG - Intergenic
1125071305 15:35557127-35557149 AGCCAGCGGGACGCACTGGCAGG - Intergenic
1125759977 15:42089647-42089669 GGCCACAGGGAGGTGATGGCTGG + Intronic
1125914581 15:43474196-43474218 GGCCAGCTGGAGTTCCTGGTGGG - Intronic
1126069623 15:44854542-44854564 GGGCAGCGGGAGGAGCTGAAGGG - Intergenic
1126739273 15:51761271-51761293 GACCTGCAGGAGGTGCTGACCGG + Intronic
1127148589 15:56050548-56050570 GGCCACTGGGAGATGCTAGCAGG + Intergenic
1128374456 15:67065498-67065520 CGCCCGCGGGAGGAGGTGGCGGG + Intronic
1128711601 15:69876261-69876283 GGAGCGTGGGAGGTGCTGGCTGG - Intergenic
1128721925 15:69956438-69956460 GGACAGCAGGAGGGGCTGGCAGG - Intergenic
1128906392 15:71471498-71471520 GGACAGCAGGAAGTGGTGGCTGG - Intronic
1129158290 15:73732464-73732486 GGCCAGCGCGAGTTCCGGGCGGG - Intergenic
1129459384 15:75692838-75692860 GGCCAGCGAGGGGTTGTGGCGGG + Intronic
1129471565 15:75758455-75758477 AGCCCGCAGGAGGTGCTGGAGGG - Intergenic
1129744374 15:78007914-78007936 GGCCAGCGGGAGGTGCTGGCAGG - Intronic
1130360459 15:83180014-83180036 GGGCAGAGGGAGGTGGTGGGTGG + Intronic
1130883231 15:88072795-88072817 GGAAAGCGGGCAGTGCTGGCTGG + Intronic
1132044189 15:98549776-98549798 GGGCTGCGGGAGGTGCTTGCGGG + Intergenic
1132155856 15:99494947-99494969 GGGCTGCGCGAGGTGCTTGCGGG - Intergenic
1132578452 16:674585-674607 GGCCAGAGGGAGGGACGGGCTGG + Intronic
1132608059 16:801687-801709 GGCCCTCGGTGGGTGCTGGCAGG + Intergenic
1132747683 16:1443769-1443791 GCCCTGCAGGGGGTGCTGGCGGG - Intronic
1132863932 16:2084558-2084580 GGCGAGCGGGGGGAGCTGGAAGG - Exonic
1132885053 16:2178887-2178909 GGCCCGCGGTAGGTGCGGGGCGG - Exonic
1133222539 16:4324974-4324996 GCCCAGCAGCAGGGGCTGGCGGG - Intronic
1135740147 16:24968203-24968225 GGCCTATAGGAGGTGCTGGCAGG + Intronic
1135759546 16:25126155-25126177 AGCCGGTGGGAGTTGCTGGCTGG + Intronic
1135881706 16:26263829-26263851 GGCCAATGGAAGGTACTGGCAGG - Intergenic
1136115356 16:28091104-28091126 GGCCTGCGGGGGGCGCTGTCAGG - Intergenic
1136561597 16:31042340-31042362 GGCCACCGGGAGGCGCAGTCGGG - Intronic
1136561604 16:31042361-31042383 GGCCACCGGGAGGCGCTGCGGGG - Intronic
1136590800 16:31216603-31216625 CGCCCCCGGGAGGGGCTGGCCGG + Intronic
1137614280 16:49837633-49837655 GGGCAGGGGCAAGTGCTGGCAGG - Intronic
1138105177 16:54284201-54284223 GGCCAGGGGGACTGGCTGGCGGG - Intronic
1138363221 16:56450962-56450984 CGCCAGCGGGAGTTGGAGGCGGG + Intronic
1138502567 16:57456820-57456842 GGCCAGCGTCAGGAGCTGGTGGG + Intronic
1138580719 16:57939116-57939138 GGCCTGCAGGAGGGGCTGGCAGG + Intronic
1138689490 16:58754063-58754085 AGCCAGCCCGAGCTGCTGGCCGG - Intergenic
1139482706 16:67239366-67239388 GAGCAGCGGGAGATGCTGGAGGG - Exonic
1139969313 16:70763815-70763837 GGACAGCGGGTGCTGCTGGGAGG + Intronic
1140249049 16:73278574-73278596 AGCGAGTAGGAGGTGCTGGCTGG + Intergenic
1140481839 16:75266268-75266290 GGCCGGCGGAAGGTGATCGCGGG + Intronic
1140722551 16:77784695-77784717 GGCCAGCTGGAGTTCCTGGTGGG - Intergenic
1140838089 16:78814136-78814158 CGGCAGCGGGAGGATCTGGCCGG - Intronic
1140891823 16:79291290-79291312 GGACAGTGGGAGGTGCTGGTGGG + Intergenic
1140927782 16:79599960-79599982 GGCCAGCGGGCTGTGCTGGGTGG + Exonic
1141097722 16:81174801-81174823 GGCCAGCTGGAGGAGCTGCTCGG + Intergenic
1141275583 16:82584939-82584961 TGGCAAAGGGAGGTGCTGGCAGG + Intergenic
1141435624 16:83998197-83998219 GACCAGCTGCAGGTGCTGCCGGG - Exonic
1141513905 16:84530350-84530372 GGCCAGTGGGAGGCACTAGCAGG + Intronic
1141812122 16:86382766-86382788 AGGCAGAGGGAGGAGCTGGCTGG - Intergenic
1142174050 16:88636871-88636893 GGCCAAGAGGAGGTGCTGGAGGG + Intergenic
1142177510 16:88651817-88651839 GGCCTGGGGGAGGGGCAGGCTGG - Intergenic
1142203398 16:88771651-88771673 GGCCATAGGGAGGTGCTGGGTGG + Intronic
1142262577 16:89049780-89049802 GCACAGGGGGAGGGGCTGGCCGG + Intergenic
1142312167 16:89320503-89320525 GGTCAGGGCCAGGTGCTGGCCGG - Intronic
1142329590 16:89442855-89442877 GGCCCGTGGGAGGTGGTGGCCGG - Intronic
1142348653 16:89569968-89569990 GTCCTGTGGGAGGTGATGGCCGG - Intergenic
1142423715 16:89989423-89989445 CCCCATCGGGAGGTGCTGGGGGG - Intergenic
1142481939 17:224370-224392 TCCCAGCGGGAGGTGCTGGCAGG - Intronic
1142863316 17:2776523-2776545 GGGCACCGGGAGGCGGTGGCAGG - Intergenic
1143102344 17:4511420-4511442 GGCCGGAGGGCGGGGCTGGCAGG + Intronic
1143189972 17:5033893-5033915 GCCCAGAAGAAGGTGCTGGCAGG + Exonic
1143655510 17:8291322-8291344 AGCCAGTGGGAGGTACTGCCTGG - Exonic
1146892216 17:36513594-36513616 GGTCAGCGCAAGGTGCTGGATGG + Intronic
1147966967 17:44199163-44199185 GGCCGGCCGGGGCTGCTGGCGGG - Intronic
1148461856 17:47843594-47843616 GGTCAGCGGGAGGAGCTGCATGG + Intergenic
1149002151 17:51768528-51768550 AGCCAGCAAGAGTTGCTGGCTGG + Intronic
1149655753 17:58308861-58308883 GGCTAGCGGGAGAGGCCGGCTGG - Exonic
1150216937 17:63476488-63476510 CGCCTCCGGGAGGTGCTGGAGGG - Intergenic
1150526766 17:65931836-65931858 GCCCAGCCTGAGGTGCAGGCAGG + Intronic
1151214661 17:72569367-72569389 GCCCAGGAGGAGGGGCTGGCGGG + Intergenic
1151482734 17:74379919-74379941 GGCCAGCAGGAGGGGCTGGCAGG - Intergenic
1151540032 17:74760117-74760139 GGCCCGGGGGAGGGCCTGGCTGG + Intronic
1151574706 17:74946885-74946907 GGCCTGCTGGTGCTGCTGGCAGG + Exonic
1151678474 17:75611885-75611907 GGCCATCGGGACGCCCTGGCTGG + Intergenic
1151774459 17:76189957-76189979 TGCCAGTGGGAGGTGCTGGAAGG - Intronic
1151786097 17:76275772-76275794 GGCCAGCGGGGAGGCCTGGCAGG + Intronic
1151966391 17:77433844-77433866 GGCCAGCGGGAGGGGCAGAGAGG - Intronic
1152122625 17:78428127-78428149 GGGCAGCCGGATGTGCAGGCAGG - Intronic
1152188518 17:78873998-78874020 GGCCTGCGGGAGGTGCTGGGGGG + Intronic
1152280938 17:79384589-79384611 GGCCTGAGGAGGGTGCTGGCAGG - Intronic
1152342271 17:79731678-79731700 AGCCAGCTGGAGGGGCGGGCAGG - Intronic
1152376674 17:79922217-79922239 GGCTGGTGGGAGGGGCTGGCGGG - Intergenic
1152466296 17:80468457-80468479 GGCTGGCCGGAGGTGCTGGCAGG + Exonic
1152501027 17:80709119-80709141 GCCCTGCGGGAGGAGCTGGGTGG - Intronic
1152568050 17:81108860-81108882 GGCCAACGGGAGCTGCTGAAAGG + Intronic
1152593112 17:81223211-81223233 GGGCGGCGGGAGGAGCTGGCCGG + Intergenic
1152635625 17:81429481-81429503 GGCCAGGGTGAGAGGCTGGCTGG + Intronic
1152686646 17:81696946-81696968 GGCCAGCGGCAGGGGCCGGCTGG - Exonic
1152773839 17:82187680-82187702 GGGTTGCGGGGGGTGCTGGCGGG + Intronic
1153095126 18:1392271-1392293 GGCCAATGGGAGGCACTGGCAGG - Intergenic
1153639135 18:7139765-7139787 GTCCAGGTGAAGGTGCTGGCAGG + Intergenic
1154095753 18:11413640-11413662 TGCCACCAGGAGGTGCTGGGTGG - Intergenic
1155003291 18:21706561-21706583 GGCCAGCGGGAGTTCCGGGTGGG + Intronic
1156783712 18:40882723-40882745 CGCCAGCCAGAGGTCCTGGCTGG + Intergenic
1157322159 18:46642842-46642864 GGACAGCAAGAGCTGCTGGCAGG - Intronic
1158616306 18:58990923-58990945 GGCAGGTGGGAGGTGCGGGCAGG - Intergenic
1160011394 18:75109290-75109312 GGCCCATGGGAGGAGCTGGCTGG - Intergenic
1160236136 18:77087966-77087988 GGGGAGCGGGAGGAGCAGGCAGG + Intronic
1160750379 19:731275-731297 GGCCAGCGGGAGTGGGTGCCTGG - Intronic
1160763494 19:797301-797323 GGCCAGTGGGAGGTGCTGGCGGG + Exonic
1160789639 19:917548-917570 GGGCAGCCGGAGGCGTTGGCCGG - Exonic
1160922815 19:1528737-1528759 GGCAGGCGGGAGGTGTGGGCAGG - Intronic
1161024965 19:2032530-2032552 GGTCAGCGGGGGGGCCTGGCAGG + Intronic
1161032454 19:2064461-2064483 GCCAAGCGGGAGGAGCAGGCAGG + Intergenic
1162101680 19:8342889-8342911 GCCCAGCGCGAGGGGCTGGCTGG + Intronic
1162145339 19:8609616-8609638 GGCCTGCGGGAGGAGGGGGCCGG + Intronic
1162403667 19:10461199-10461221 GGCCTGGGGGCGGGGCTGGCTGG + Intronic
1162757225 19:12867585-12867607 GGCAAGCGGGAGGGGCTGGGCGG + Exonic
1163472597 19:17506036-17506058 GGCCAGGGGGTGCTGCTGGAGGG - Exonic
1163535860 19:17876055-17876077 GGCCAGCGTGAGCACCTGGCGGG - Exonic
1165320358 19:35081013-35081035 GGCCGGCAGAACGTGCTGGCTGG - Intergenic
1165420867 19:35721256-35721278 GGCCTCCGGGAGGAGGTGGCAGG - Exonic
1165858950 19:38896941-38896963 GGAGAGCCGGAGGTGCTGACGGG + Intronic
1166218815 19:41352833-41352855 AGCCAGGGGGAGGTGCCGCCCGG - Exonic
1166391182 19:42409749-42409771 GGACACAGGGAGGAGCTGGCTGG + Intronic
1166643380 19:44513108-44513130 GGCCAGCAGGGGGCGCTTGCCGG - Intronic
1166862784 19:45819433-45819455 GGACCGAGGGAGGTGCTTGCTGG - Intronic
1166983890 19:46648743-46648765 GGCCTGCGGGAGGCGTCGGCGGG - Exonic
1167200483 19:48061880-48061902 GGCAATGGGGAGGTGCTGGCTGG - Intronic
1167374011 19:49101753-49101775 GGCCAGCTGGAGGTGGGGGGAGG + Intronic
1167384300 19:49155163-49155185 GGCCGGGGGGAGGAGCAGGCTGG + Exonic
1167706263 19:51082937-51082959 GGGCGGCGGGAGGTGGGGGCAGG - Intronic
1167749246 19:51369924-51369946 GGCTAGCCGGGGGTGATGGCAGG + Intergenic
1168173868 19:54608819-54608841 GGGCAGAGGCAGGTGCGGGCTGG - Intronic
1168228699 19:55014987-55015009 GGTCAGCGGGAGGGGCGGGAGGG + Exonic
1168351462 19:55678536-55678558 AGGCTGCGGCAGGTGCTGGCAGG - Exonic
1168354844 19:55694725-55694747 GGAGAGCTGGAGCTGCTGGCAGG + Exonic
1202695089 1_KI270712v1_random:117829-117851 AGTCAGTGGGAGGGGCTGGCGGG + Intergenic
1202711934 1_KI270714v1_random:23743-23765 GGGCAGGGGCAGGGGCTGGCAGG - Intergenic
925905576 2:8537961-8537983 TGCCAGCAGAAGGGGCTGGCTGG - Intergenic
926127688 2:10282043-10282065 GGGCACTGGCAGGTGCTGGCAGG + Intergenic
927905095 2:26849613-26849635 GCCCAGCAGCAGGTGCTGCCAGG + Intronic
928166567 2:28976801-28976823 GCCCAGTGGCAGGTGCTGGTTGG + Intronic
928412738 2:31067103-31067125 GGCTGGCGGGAGGTAATGGCAGG - Intronic
929456876 2:42072458-42072480 GGGCTGCGGTAGGTGCTGGCAGG + Intergenic
929609558 2:43260130-43260152 GACCAGCTGGATGTGGTGGCGGG - Intronic
929922424 2:46182177-46182199 GTCCAGAGGGAGGAGCGGGCTGG - Intronic
931348738 2:61470547-61470569 GGCCTGCGGGAGGCGACGGCCGG - Intronic
932274622 2:70442817-70442839 AGCCAGTGGGAGGCACTGGCAGG - Intergenic
932893131 2:75613067-75613089 GGCCAATGGGAGGTGCTGGTGGG - Intergenic
933560092 2:83877386-83877408 GTCCAGCTGGAGGAGCTGGAGGG + Intergenic
933589345 2:84214645-84214667 GGCCAGTGGGAGGTGCTGGCTGG - Intergenic
934276259 2:91574878-91574900 AGTCAGTGGGAGGGGCTGGCGGG + Intergenic
935371397 2:102350689-102350711 GGCCAATGGGAGGCACTGGCAGG + Intronic
935796325 2:106644773-106644795 GGACAGCGAGATGGGCTGGCAGG + Intergenic
935878386 2:107536406-107536428 GGCCAGCGTGAGTTCCTGGTGGG - Intergenic
936145480 2:109977955-109977977 GACCACAGGGAGGTGCTGGGAGG + Intergenic
936199206 2:110393523-110393545 GACCACAGGGAGGTGCTGGGAGG - Intergenic
937843463 2:126551696-126551718 GGTCAGTGGGAGTTACTGGCAGG - Intergenic
938255649 2:129858165-129858187 GGTCTGGGGTAGGTGCTGGCAGG + Intergenic
938368797 2:130756161-130756183 GGCCAGCGGGAGGGGCGGGCCGG - Intronic
939881292 2:147634321-147634343 GGCCTGAGGAAGGTGCTTGCAGG - Intergenic
941397962 2:164995072-164995094 GGCCAGCTGGAGTTCCTGGTGGG - Intergenic
942195128 2:173509501-173509523 GGCCAGCGGGAGTTTCTAGCCGG - Intergenic
942456380 2:176140997-176141019 GCCCAGCGGGAGGGGCTGGTTGG - Intergenic
944461549 2:199955444-199955466 GGGTACCGGGAGGTGCTGCCCGG + Exonic
944681058 2:202077105-202077127 GGACAGAGGGAGGAGCTGGTGGG - Intronic
945314933 2:208360802-208360824 GGCCAGCGGTAGGTGCGGCTGGG - Intronic
947749359 2:232524651-232524673 GGCCATCCTGAGGTGCTGGTGGG + Intronic
947873215 2:233451060-233451082 GGCCAGCAGGAGGGACTGGTGGG + Intronic
948087726 2:235265531-235265553 GGCCAGCTGGAGGCCCTGGCAGG + Intergenic
948488556 2:238296892-238296914 GCCCAGAGCGTGGTGCTGGCAGG - Intergenic
948616405 2:239202101-239202123 GGCGAGCGGGTGCTGCTGGAGGG + Intronic
948806463 2:240455421-240455443 GGCCAGAGGGAGGGGTGGGCCGG + Intronic
948812894 2:240494012-240494034 GGCCTGCAAGTGGTGCTGGCAGG + Intronic
948909427 2:240995647-240995669 TGCCAGGGGCAGGGGCTGGCTGG - Intergenic
948942691 2:241204073-241204095 GGGCAGCGGGCGGGGCCGGCAGG + Intronic
949069779 2:242017459-242017481 GGTTAGCCGGAGGTGGTGGCAGG + Intergenic
1168796440 20:612805-612827 GGAGAGCTGGGGGTGCTGGCAGG - Intergenic
1169832393 20:9838900-9838922 GGCCAGCGGGAGGGGGTGAGAGG + Exonic
1170008580 20:11695641-11695663 GGACAGGGAGAGGTGGTGGCGGG - Intergenic
1170924789 20:20712718-20712740 GCCCCGCGGGAGGTGCCGGCCGG + Intergenic
1172006441 20:31821741-31821763 GGCCAGGGGCAGGTGGGGGCTGG + Intronic
1172123509 20:32612091-32612113 GGCCAATGGGAGATGCTGGGAGG - Intergenic
1172874611 20:38156612-38156634 GGCCAGCGGAGGATGCTGGCTGG + Intronic
1173183034 20:40818954-40818976 GGCCAATGGGAGGTATTGGCAGG - Intergenic
1174592731 20:51658952-51658974 GGACAGCTGGAGATGCAGGCAGG - Intronic
1175166788 20:57049529-57049551 GGCCCGCTGGAGGGGATGGCAGG - Intergenic
1175237494 20:57524941-57524963 GGGCGGAGGGAGGGGCTGGCCGG - Intronic
1175870861 20:62208811-62208833 AGCAAGGGGGAGGTGGTGGCAGG + Intergenic
1176212530 20:63931977-63931999 GGCCGGAGGCAGGTGCTGCCTGG + Exonic
1176259485 20:64172008-64172030 GGCCAGTAGGAGGGGCTGGCAGG - Intronic
1176303141 21:5108438-5108460 GGGCCGAGGGAGGGGCTGGCTGG - Intergenic
1178350592 21:31870683-31870705 GGGTAGGGGGTGGTGCTGGCCGG - Intergenic
1179365431 21:40754684-40754706 GGGCAGCTGGAAGTGCTGCCAGG + Intronic
1179392695 21:41008349-41008371 ACCAAGCGGGAGATGCTGGCTGG + Intergenic
1179580199 21:42338632-42338654 GGCCACAGGGAGGTGCAGCCTGG - Intergenic
1179853884 21:44153486-44153508 GGGCCGAGGGAGGGGCTGGCTGG + Intergenic
1180920846 22:19520842-19520864 GGACAGAGCCAGGTGCTGGCTGG - Intergenic
1181047185 22:20220653-20220675 GGACAGCAGGAAGGGCTGGCTGG + Intergenic
1181047546 22:20222765-20222787 GAGCAGCAGGAGGGGCTGGCTGG + Intergenic
1181318240 22:21985041-21985063 GGCCAGCAGGAGGCGCTGAGTGG + Intergenic
1181509668 22:23383521-23383543 GGCCAGCTGGAGGCGCCGGGCGG + Intergenic
1183208251 22:36433809-36433831 GGCCAGCGGGAGGGGCGGGCTGG + Intergenic
1183343373 22:37294205-37294227 GGCGGGCGGGGGGTGCAGGCAGG + Intronic
1183404469 22:37623684-37623706 GGCCTGGGGGAGGTGGGGGCAGG - Intronic
1183521567 22:38298701-38298723 GGCCAGAGTGAGCTGGTGGCGGG - Intronic
1183570304 22:38648257-38648279 GGCCAGGGAGAAGGGCTGGCAGG + Intronic
1183668184 22:39257015-39257037 GGCCAGAGGGAGGGCCTGGAAGG + Intergenic
1183752222 22:39728054-39728076 GGGCGGCGGGGGGTGGTGGCGGG - Intergenic
1183964892 22:41435708-41435730 GGCCACAGGGAGTTGCTGGCTGG - Exonic
1184615948 22:45639026-45639048 GGCCAGGAGGAGGTGCTGAGTGG + Intergenic
1184689130 22:46109546-46109568 GGCCAACGGGGGGAGCTTGCTGG - Intronic
1184730935 22:46370707-46370729 GGGCAGTGGGAAGTGCTGGAGGG - Intronic
1184865069 22:47197716-47197738 TCCCAGCGGGAGGGGCTGGCTGG + Intergenic
1185072132 22:48662187-48662209 GGACAGCGGGAGGAGCTCACAGG + Intronic
1185118643 22:48952511-48952533 GGCCATCGGGAGCGGCTGGCAGG - Intergenic
1185155315 22:49190168-49190190 GGCCCGAGGGAGGTGCTCACTGG + Intergenic
1185247657 22:49781606-49781628 TGCCAGCGGCAGGGGCGGGCAGG - Intronic
1185366702 22:50440125-50440147 GGGCAGTGGGAGGAGGTGGCCGG + Intronic
1185408794 22:50672347-50672369 GGCCAGCAGAAGGTGGTGGATGG - Intergenic
950084510 3:10248243-10248265 GGCCAGCCAGATGTGCAGGCAGG - Exonic
950088325 3:10277335-10277357 GGACATCTGGAGGTGCTGCCAGG + Intronic
950197708 3:11020965-11020987 GACCATTGGGAGGAGCTGGCAGG - Intronic
950235834 3:11319578-11319600 GTCCAGAGGGAGGTTCAGGCCGG - Intronic
950261177 3:11544265-11544287 GGCCACAGGGAAGTGCTGCCGGG - Intronic
950544270 3:13629453-13629475 GGCCAGAGCCAGGTCCTGGCAGG - Intronic
950544696 3:13631435-13631457 GGCCAACGGGAGGTCCTGCAAGG + Exonic
951038021 3:17954985-17955007 AGCCAGAGGGAAGTACTGGCAGG - Intronic
951146613 3:19234578-19234600 GGCCTGCGGACGGTGCTTGCGGG - Intronic
952272673 3:31848008-31848030 AGCCTGAGGGAGGTGCTGGCAGG - Intronic
953537670 3:43788443-43788465 GGCAAGGTGGAGATGCTGGCAGG - Intergenic
953548828 3:43884822-43884844 GGCCCATGGCAGGTGCTGGCAGG + Intergenic
954104017 3:48399369-48399391 GGCCAACGGGACGGGCTGGCAGG + Intronic
954364582 3:50139219-50139241 GTGCAGCTGGAGGTGCTGGGTGG + Intergenic
954364889 3:50140432-50140454 GGCCAGAGTGTGGTGCTGTCTGG - Intergenic
954447241 3:50553333-50553355 GTCCAGCTGGAGGGGCTGGCAGG - Intergenic
954553743 3:51502762-51502784 GGGGAGGGGGAGGTGTTGGCAGG - Intergenic
954613507 3:51958240-51958262 GGCCAGGGGGAGCTGTGGGCAGG + Exonic
954707877 3:52490665-52490687 GGACAGAGGGAGGCGGTGGCAGG - Intronic
955210255 3:56934488-56934510 GGGCTGCGTGCGGTGCTGGCGGG + Intronic
956466498 3:69525305-69525327 GGACAGCAGGAGGAGGTGGCTGG + Intronic
956738472 3:72256901-72256923 GGCCACCGGGAGCTGGTGCCAGG - Intergenic
957560193 3:81812310-81812332 GGCCAGCTGGAGTTCCCGGCAGG - Intergenic
960055396 3:113273201-113273223 GGAGAGCCGGAGGCGCTGGCTGG - Exonic
960708477 3:120504458-120504480 GGCCAGTGGGAGGGGCTGGCAGG + Intergenic
961364781 3:126392389-126392411 GGAAGGCGGGAGGTGCAGGCAGG + Intergenic
962259236 3:133892621-133892643 GGCCAGGGGAAGGAGCTGGAGGG - Intronic
964378502 3:156073183-156073205 GGGCTGCGGGCGGTGCTTGCGGG + Intronic
964605170 3:158553145-158553167 GGCCAACGGGAGGGACTGTCAGG + Intergenic
964802915 3:160574282-160574304 GGGCAGCGGGTGGTGCTTGCGGG - Intergenic
967054892 3:185823615-185823637 GGCCACCGGGAGGAGAGGGCAGG - Intronic
967691334 3:192477255-192477277 GTCCAGTGGGAAGCGCTGGCAGG - Intronic
968045572 3:195622377-195622399 GGCCTGGGGAAGGTGCTGGGGGG + Intergenic
968045662 3:195622637-195622659 GGCCTGGGGAAGGTGCTGGGGGG + Intergenic
968064346 3:195750329-195750351 GGCCTCGGGGAGGTGCTGGGGGG + Intronic
968064359 3:195750363-195750385 GGCCTGGGGAAGGTGCTGGGGGG + Intronic
968064374 3:195750402-195750424 GGCCTGGGGAAGGTGCTGGGGGG + Intronic
968134986 3:196214806-196214828 AGCCAGCGGGAGGCCCTGCCTGG - Intronic
968518343 4:1024123-1024145 GGCGGGCGGGGGGTGCTGGTGGG + Intronic
968522575 4:1040696-1040718 GGGCTGCGGAGGGTGCTGGCAGG + Intergenic
968658947 4:1791121-1791143 GACCAGTGGGCAGTGCTGGCAGG - Intergenic
968938979 4:3628206-3628228 CGCCTGCAGGAGATGCTGGCCGG + Intergenic
968994799 4:3938663-3938685 GGCCAGCGGGAGGCTCAGGGAGG + Intergenic
970423761 4:15928303-15928325 TGACAGTGGGAGGTGCTGCCTGG + Intergenic
970445069 4:16116586-16116608 GGACAGAGCCAGGTGCTGGCAGG - Intergenic
971209154 4:24599433-24599455 GGCCAGCGCGAGTTCCTGGTAGG - Intergenic
972533110 4:39977770-39977792 GGCCGGCGCGAGGTGCGTGCGGG - Exonic
972890435 4:43551208-43551230 GTCAAGGGAGAGGTGCTGGCGGG + Intergenic
973366021 4:49210263-49210285 GTCAAGGGTGAGGTGCTGGCAGG + Intergenic
975439983 4:74399401-74399423 GGGCTGCGGGTGGTGCTTGCTGG - Intergenic
975712622 4:77175504-77175526 GGCCAGCTGCACGTGCTAGCTGG - Intronic
976287848 4:83387186-83387208 GGCCAGTGGGAGGCACTGGCGGG - Intergenic
976334556 4:83870522-83870544 GGCCAATGGGAGGTGCTGGTAGG + Intergenic
976368549 4:84259417-84259439 GGCCAGTAGGTGGTGCTTGCAGG - Intergenic
976520657 4:86021925-86021947 GGCCAGCTGGAGTTGCAGGTAGG - Intronic
978463639 4:108984669-108984691 GGCCAGCGGGAGTTCCGGGTGGG - Intronic
981354609 4:143774155-143774177 GGCCAGCAGGTGGTGCTTACAGG + Intergenic
982408198 4:155044347-155044369 GGCCAGCTGGAGTTCCTGGTGGG + Intergenic
983026069 4:162739584-162739606 GGCCAGCTGGAGTTCCGGGCGGG + Intergenic
984765736 4:183398994-183399016 TGGCAGCGGGAGGTTCTGGATGG - Intergenic
985590089 5:759989-760011 GGCCAGCGGGAGGGGCAGCATGG + Intronic
985631958 5:1018454-1018476 GGCCTGGGGAAGGTGCTTGCGGG + Intronic
986234689 5:5895865-5895887 GTACAGCAGGAGGTGATGGCAGG + Intergenic
986315334 5:6583150-6583172 GGCCAGCAGGGGATGCTGCCGGG - Intergenic
987090168 5:14503289-14503311 TGCCAGAGGGTGCTGCTGGCTGG - Intronic
987156822 5:15096893-15096915 GGGCTGCGGGGGGTGCTTGCGGG - Intergenic
987308979 5:16664661-16664683 GTCCACAGGGAGGTGCAGGCAGG + Intronic
987315268 5:16717995-16718017 GGCCAGCTGGAGTTGCGGGTGGG + Intronic
987365016 5:17140972-17140994 GGCCAGCGGGAGTTCCGGGTGGG + Intronic
992001377 5:72439616-72439638 GGCAAGTGGGAGGTGAAGGCAGG - Intergenic
992489852 5:77231919-77231941 GACCAGTGGGAGGCACTGGCAGG - Intronic
992828096 5:80569535-80569557 GGGCAGCAGGAGGTGCCGGCTGG - Intronic
993202233 5:84830613-84830635 GGCCAGCGGGAGTTCCAGGTGGG - Intergenic
994157817 5:96523188-96523210 TGCCAGGAGGAGGTGCTGCCTGG + Intergenic
995019556 5:107351831-107351853 GGCCAGTGGCAGGTTCTGCCTGG + Intergenic
995099325 5:108279026-108279048 GGCCAGCAGGTGGTGCTTACAGG - Intronic
996478720 5:123949504-123949526 GGCCAGCGGGAGTTCCGGGTGGG - Intergenic
997975969 5:138441357-138441379 GGACAGAGGGAAGCGCTGGCTGG - Intronic
998135037 5:139669998-139670020 GGCCTGGGGGAGGTGCTGGGGGG + Intronic
998161455 5:139814963-139814985 GGCCAGGGGCAGGTGGTGGGTGG - Intronic
998191447 5:140028627-140028649 GGCCAGGGGGAGGTTTTGGGTGG + Intronic
999177033 5:149638946-149638968 GGCCAATGGGAGGCACTGGCAGG + Intergenic
1000128231 5:158268509-158268531 GGCCAGGGAGAGCTGCTGCCAGG + Intergenic
1000329219 5:160194213-160194235 GGCCAGCTGGAGTTGCCGGTGGG - Intronic
1001276350 5:170354381-170354403 GGCCAGTGGGAGGTGGTGATGGG + Intronic
1001530234 5:172456070-172456092 GGCCAGTGGAAGGGCCTGGCAGG + Intergenic
1002442222 5:179270429-179270451 AGCTGGCAGGAGGTGCTGGCTGG - Intronic
1002523222 5:179802670-179802692 GCCCAGCTGGAGGTTCTGACAGG - Exonic
1003176848 6:3758208-3758230 GGCCAGCGCGAGTTCCGGGCGGG + Intergenic
1003590318 6:7431820-7431842 AGCCAGGGGGAGGAGCTGGTTGG + Intergenic
1003882075 6:10488052-10488074 GGCCAGCGCGAGTTCCGGGCGGG - Intergenic
1004053978 6:12115843-12115865 GGCTCGCGGGGGGTGCTGGTTGG + Intronic
1004070248 6:12291227-12291249 CGCCTGCGGGGGGTGGTGGCGGG - Intronic
1004234235 6:13860157-13860179 GGGCTGCGGGAGGCGCTTGCGGG + Intergenic
1006437032 6:34031058-34031080 GGCCACCAGGAGGTGGTAGCAGG + Intronic
1006642724 6:35497127-35497149 GCGCAGGGGGCGGTGCTGGCCGG + Intergenic
1006869830 6:37241509-37241531 GGCTAGAAGCAGGTGCTGGCAGG + Intronic
1007085294 6:39140116-39140138 TGCCAGTGGGAGGCACTGGCAGG + Intergenic
1007336981 6:41161262-41161284 GTCCTGGTGGAGGTGCTGGCAGG - Exonic
1008015459 6:46513629-46513651 GACCAGCAGGAGGTTATGGCTGG - Intergenic
1010066271 6:71686204-71686226 GGCCAGCGGGAGTTCCGGGTGGG + Intergenic
1011055340 6:83197927-83197949 GGCAAGCTGGAGGACCTGGCGGG - Exonic
1011904102 6:92339377-92339399 GACCAGTGGGAGAGGCTGGCAGG + Intergenic
1014788446 6:125644496-125644518 GGCCAGCGGGAGTTCCGGGTGGG + Intergenic
1017039396 6:150295598-150295620 AGCCAGTGGGAGGCACTGGCAGG - Intergenic
1019134354 6:169899043-169899065 GGCCAGCGTGGGGCGCCGGCAGG + Intergenic
1019261134 7:82576-82598 AGGCAGCGGGAAGTGCGGGCTGG - Intergenic
1019299148 7:294851-294873 GACCGGAGGGAGGTGCAGGCAGG + Intergenic
1019433009 7:1008009-1008031 GAGCAGCGGAAGGTGCTGGCAGG + Intronic
1019605813 7:1909664-1909686 GACCAGCCCGAGGGGCTGGCAGG + Intronic
1019729228 7:2621302-2621324 GGCCAGCTGGAGGTGGGGGAGGG - Intergenic
1022089101 7:27096307-27096329 GGCCTCCGGGAGGTGGGGGCTGG + Intergenic
1022597364 7:31725231-31725253 GGCCATCGGGAGGTACTGGTAGG + Intergenic
1024063633 7:45716154-45716176 GGGCAGAAGGAGGTGCTTGCAGG + Exonic
1024691249 7:51805879-51805901 GGCCAGCTGGAGTTCCTGGTGGG + Intergenic
1026019796 7:66698043-66698065 GGGCAGCGGGAGGGAGTGGCTGG - Intronic
1028058766 7:86282475-86282497 GGCCAGCGTGAGCTGCCGGTGGG - Intergenic
1029650791 7:101890067-101890089 GGCCAGTGGCAGGGACTGGCTGG + Intronic
1029809648 7:103034519-103034541 GGCCAGCGGGAGTTCCGGGTGGG - Intronic
1031369806 7:120950950-120950972 CGCCAGTGGGACGTGCGGGCGGG + Intronic
1031401319 7:121328944-121328966 GGCCAGGGGGAGGAGATGGGAGG + Intronic
1031475473 7:122216013-122216035 GGCCAGCCGGAGGTGGTCACAGG - Intergenic
1032443385 7:131959651-131959673 GGCCAGTGGGAGTAGCTGGCTGG + Intergenic
1033653970 7:143361575-143361597 GGTCACCGGGAGGTGTAGGCGGG + Intronic
1034779059 7:153860385-153860407 GGCCAGTGGGAGGCACTGGAAGG + Intergenic
1036432921 8:8706378-8706400 AGGCTGCGGGAGGTGCTGTCAGG + Intergenic
1036821353 8:11942499-11942521 GGCCAGGAGGAGGAGCAGGCAGG + Intergenic
1036950245 8:13133307-13133329 GCCCAGCGGGAGGGCCCGGCTGG - Intronic
1037707437 8:21326960-21326982 GGCCAGCGGGACGTGCAGGTGGG + Intergenic
1039171356 8:34749512-34749534 AGCCAACGGGAGGTGCTGGAGGG - Intergenic
1039600473 8:38832601-38832623 GCCCAGCAGTAGGTGGTGGCTGG + Intronic
1039876039 8:41587002-41587024 GGCCAGGGGATGGTTCTGGCTGG + Intronic
1040007368 8:42631640-42631662 GGCCAGGGAGAAGTGGTGGCAGG + Intergenic
1040545797 8:48396997-48397019 GGCCTGCGGCAGGTGAAGGCAGG - Intergenic
1040807435 8:51409284-51409306 GGGCGGCGGGAGGGGCTGGCGGG + Exonic
1040930871 8:52733776-52733798 TGCTAGCGAGAGGTACTGGCAGG - Intronic
1041306776 8:56469914-56469936 CGCCTGCTGGAGGTGCTGCCTGG + Intergenic
1043857130 8:85276085-85276107 GGGCTGCGGGCGGTGCTTGCGGG + Intronic
1045368911 8:101501587-101501609 GGCCAGCAGGGGCTGCTGCCGGG + Intronic
1046288876 8:112132736-112132758 GGCCAGCTGGAGTTGCGGGCGGG + Intergenic
1047441222 8:124880260-124880282 GGCCATTGGGAAGTGCTGGGGGG + Intergenic
1047753645 8:127901247-127901269 GGGCTGCTGGAGGGGCTGGCTGG + Intergenic
1049716650 8:144096051-144096073 TGGCAGCGGGAGGTTCTGGGTGG + Intronic
1049767128 8:144360066-144360088 GCCCAGAAGAAGGTGCTGGCGGG - Exonic
1049774787 8:144399225-144399247 GGCCCGCTGGGGGCGCTGGCTGG + Intronic
1049812275 8:144580835-144580857 GGACAGCGGCAGGTGAGGGCGGG - Exonic
1050429690 9:5549950-5549972 AGCCAATGGGAGGTGCTAGCAGG - Intronic
1051697960 9:19789082-19789104 GCCCAGAGGGAGGGGCCGGCGGG - Intergenic
1053005179 9:34599527-34599549 CACCAGAGGGAGGTGTTGGCTGG + Intergenic
1053027320 9:34740574-34740596 GGGCTGCGCGAGGTGCTTGCGGG - Intergenic
1053475219 9:38377622-38377644 GGCCAGCGGGAGTTCCGGGTGGG + Intergenic
1055030641 9:71768978-71769000 GGCCGGCGGGAGGGGCCGGGCGG - Intronic
1055397882 9:75892573-75892595 AGGGAGAGGGAGGTGCTGGCTGG + Intronic
1055593549 9:77843200-77843222 GGCCAGAGGGAGGAGCAGGGAGG - Intronic
1056825319 9:89872960-89872982 GGGGAGCAGGAGGTGCTGCCTGG - Intergenic
1057624774 9:96667499-96667521 GGCCACCTGGATGTGCTGGATGG - Intergenic
1057783990 9:98073143-98073165 GGACAGAGGCAGGTGCTGGAGGG - Intronic
1060786312 9:126454063-126454085 GACCAAAGGGAGGTGCTAGCAGG - Intronic
1061075786 9:128340666-128340688 GGGCGGCGGGCGGGGCTGGCGGG + Intronic
1061317999 9:129809293-129809315 GGCCAGGTGGCGGTGGTGGCAGG + Intronic
1061721932 9:132557247-132557269 TGCCAGCGTGAGGTTCTTGCTGG + Intronic
1062032096 9:134366324-134366346 GGCCTGCTGGACCTGCTGGCAGG - Intronic
1062271797 9:135713229-135713251 GGCCATGGGGAGGTGCAGGCAGG - Intronic
1062587559 9:137256074-137256096 GGTCAGCGGGAGGGGTGGGCAGG + Intronic
1062688414 9:137828173-137828195 GGCCCCAGGGGGGTGCTGGCGGG + Intronic
1185652377 X:1657770-1657792 GGCCAGCGGGGAGGGCTGCCCGG - Intergenic
1187181351 X:16946564-16946586 GGCAAGCGGGAGGCGGGGGCGGG + Intergenic
1191105058 X:56767535-56767557 GGCCACCGGGAGTTGCCGGTCGG + Intergenic
1192274458 X:69615879-69615901 GGCAAGCGGGAAGAGCTGGGTGG + Intergenic
1192482923 X:71500535-71500557 GGCCAGCGGGGGGTGGGGGCGGG - Intronic
1192684511 X:73289310-73289332 TGCAAGGGTGAGGTGCTGGCAGG - Intergenic
1193535192 X:82706713-82706735 GGAAAGGAGGAGGTGCTGGCTGG + Intergenic
1197758394 X:130011815-130011837 GGGCAGGGAGGGGTGCTGGCAGG + Intronic
1199372979 X:147073258-147073280 GGCCAGTGGGAGGTTCTGCAGGG + Intergenic
1200144900 X:153921423-153921445 GCCCTGAGTGAGGTGCTGGCCGG - Exonic
1200165542 X:154032747-154032769 GGGCTGTGGGTGGTGCTGGCCGG + Intronic
1200253053 X:154564039-154564061 GGCCTGCGGGAGGAGGTGGGTGG + Intronic
1200264714 X:154640376-154640398 GGCCTGCGGGAGGAGGTGGGTGG - Intergenic