ID: 1129747793

View in Genome Browser
Species Human (GRCh38)
Location 15:78037174-78037196
Sequence GAGGAGGCCAGGGACTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 456}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129747793_1129747804 21 Left 1129747793 15:78037174-78037196 CCCTGGGAGTCCCTGGCCTCCTC 0: 1
1: 0
2: 2
3: 37
4: 456
Right 1129747804 15:78037218-78037240 CCCTTAGCACCCTACGCACCTGG 0: 1
1: 0
2: 1
3: 1
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129747793 Original CRISPR GAGGAGGCCAGGGACTCCCA GGG (reversed) Intronic
900016080 1:151063-151085 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
900046344 1:509657-509679 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
900522179 1:3111111-3111133 CAGGGGCCCAGGGATTCCCAGGG + Intronic
900543470 1:3215716-3215738 GAGGAGGGCAGGGGCTGGCAGGG - Intronic
900613088 1:3552738-3552760 GAGGAGGCCACAGCCTGCCAGGG + Intronic
900851431 1:5146089-5146111 GAGGAGGTCAGGCTCCCCCAGGG + Intergenic
901377381 1:8849036-8849058 GGGGAGGCCACGGAGGCCCAGGG + Intergenic
902231229 1:15028961-15028983 GAAGAGGCCAGGGTCCCCGATGG - Intronic
902580758 1:17406088-17406110 GAGGAGGAAACGGTCTCCCATGG - Intergenic
902930370 1:19726900-19726922 CAGAAGGCCAGGGATTCCCACGG + Intronic
903033506 1:20479885-20479907 GAGCAGGGAGGGGACTCCCAGGG - Intergenic
903125553 1:21245113-21245135 GAGGAGGCCAGAGAGGCTCAGGG + Intronic
903231993 1:21927583-21927605 GGTGTGGCCAGGGGCTCCCATGG - Intronic
903327439 1:22577504-22577526 TATGAAGCCAGGGACACCCAGGG + Intronic
903468586 1:23569005-23569027 GGGGAGCCCAGGAACACCCAGGG + Intergenic
903682177 1:25104436-25104458 GAGGAGGGCAGGGGCTGCCTTGG - Intergenic
904259673 1:29281176-29281198 GAGGAGGTGAGGGACTGCCATGG - Intronic
904412217 1:30331333-30331355 GAGGGAGTCAGGGACTCTCAAGG - Intergenic
904487324 1:30835427-30835449 GAGGAAGCCAGGCCTTCCCACGG + Intergenic
904834399 1:33325449-33325471 AAGGAGGCCGGGGACCACCAGGG - Intronic
905174312 1:36126292-36126314 TAGAAGGCCAGGGAGGCCCACGG + Intergenic
905328057 1:37171954-37171976 GAGGAGCCCAGGGGGTCACAGGG - Intergenic
905791285 1:40791103-40791125 AATGAGGGCAGGGAATCCCAAGG + Intronic
906382610 1:45342337-45342359 GAGGAGGACAGAGTCCCCCAGGG - Intronic
907497395 1:54853975-54853997 GAGGAGACCATGGATTCCAAGGG + Intronic
907697749 1:56751049-56751071 AAGCTGGCCAGGCACTCCCAAGG - Exonic
907831358 1:58067250-58067272 GACGAGGAGAGGGACTCCCACGG + Intronic
908654379 1:66372463-66372485 GAGCAGAACAGGGACTGCCAGGG + Exonic
908658473 1:66413196-66413218 GAGGAGGGCAGGCACTTCAAGGG + Intergenic
909103242 1:71377383-71377405 GAGGGGGCCAGGGACAGCAATGG + Intergenic
912964728 1:114227767-114227789 AATGAGGGGAGGGACTCCCATGG + Intergenic
913230186 1:116735113-116735135 GAGGACGCTATGGCCTCCCAAGG + Intergenic
917969714 1:180198828-180198850 GAGGAAGACAGAGGCTCCCAGGG + Exonic
919672908 1:200354182-200354204 GAGGTGGCCAGGGAATGCTATGG - Intergenic
920084930 1:203408538-203408560 GAGGAGGGCACGGAGGCCCACGG + Intergenic
920180906 1:204131253-204131275 GTGGGGGCCAGGGCCCCCCAGGG - Exonic
920651480 1:207840539-207840561 GTGGGGCCCAGGGACTCCCTGGG - Intergenic
920914523 1:210249397-210249419 GAGAAGTCCTGGGACCCCCATGG - Intergenic
922013789 1:221621804-221621826 GAGTGGGCCAGGAACTCTCACGG + Intergenic
922101590 1:222481820-222481842 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
922103901 1:222496741-222496763 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
922262671 1:223956936-223956958 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
922264222 1:223969272-223969294 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
923038357 1:230301218-230301240 GAGCAGGCGAGGGGCTGCCAGGG - Intergenic
923275920 1:232396268-232396290 GAGGCAGTCAGTGACTCCCAAGG + Intergenic
924344510 1:243061937-243061959 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
924346071 1:243074265-243074287 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
1063362026 10:5466906-5466928 GGGAGGGCCAGGGCCTCCCAGGG + Intergenic
1064898193 10:20262751-20262773 GAGGTGGCTAGGGACTGGCATGG + Intronic
1064904487 10:20330919-20330941 GAGTAGGGCTGGGTCTCCCAAGG - Intergenic
1065323848 10:24533319-24533341 GAGAAGGCCAGGGAAGCGCATGG + Intronic
1066730275 10:38430555-38430577 GAGGAGGCCAGGGAGTTGCTGGG + Intergenic
1066731823 10:38443135-38443157 GAGGAGGCCAGGGAGTTGCTGGG + Intergenic
1068927389 10:62554432-62554454 GAGGTTGCCAGGGATTCCCTGGG - Intronic
1068956086 10:62819219-62819241 GGGGAGGCCAGGGAATGCCTGGG + Intronic
1070746288 10:78935932-78935954 GAGGAGGCCAAGGGCTGGCAGGG - Intergenic
1071462873 10:85915020-85915042 GAGGAGGCCAGGGCCAGACAGGG + Intronic
1072427674 10:95343734-95343756 CAGGATGCCAGGAAGTCCCACGG + Intronic
1073107448 10:101040322-101040344 GAGCACACCAGGAACTCCCAAGG - Exonic
1074974805 10:118571379-118571401 GCAGAGGCCAGGGTCTCACAGGG + Intergenic
1075015380 10:118906960-118906982 AAGGAGGGCAGGGAGCCCCAGGG - Intergenic
1075564570 10:123494173-123494195 GAGGAGCTAAGAGACTCCCAAGG - Intergenic
1075647852 10:124108183-124108205 GATGAGACCAGGGACCTCCAAGG + Intergenic
1076013194 10:127006770-127006792 GATGTGGCAAGGGAGTCCCATGG + Intronic
1076406244 10:130214158-130214180 GAGGAGGCCAGGGACGAATAGGG - Intergenic
1076526446 10:131115359-131115381 GAGGAGGGCAGGAAGCCCCAGGG + Intronic
1076700547 10:132270591-132270613 GAGCAGGCGTGGGACTCCAAGGG - Intronic
1076719325 10:132386380-132386402 CAGGAGGACATGGATTCCCATGG - Intergenic
1076786474 10:132752281-132752303 GAGGATGCCAGGGAAGCCCAGGG + Intronic
1076972670 11:146130-146152 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
1076995561 11:295953-295975 CAGGATGCCTGGGTCTCCCAAGG + Exonic
1077017469 11:403343-403365 GAGGAGGAAGGGGACGCCCAGGG + Intronic
1077056898 11:598183-598205 GAGGCTGCCAAGCACTCCCACGG - Intronic
1077080236 11:721762-721784 GACGGGGCCAGGGACATCCATGG + Intronic
1077194057 11:1270524-1270546 TGGTGGGCCAGGGACTCCCAAGG - Intergenic
1078131095 11:8614765-8614787 GGGGATGGCAGGGACTGCCATGG + Exonic
1078142731 11:8703538-8703560 GAGGAGGCCAGGCAGACCCCAGG - Intronic
1078267487 11:9765927-9765949 GATGAGGCCAGGGACTGCAGAGG + Intergenic
1078359236 11:10655634-10655656 CAGGATTTCAGGGACTCCCAGGG - Intronic
1079702076 11:23560597-23560619 GGTGAAGCCAGGGAATCCCAAGG - Intergenic
1080330740 11:31134387-31134409 GAGGAGTCCTGTGACTCTCAGGG - Intronic
1081654507 11:44848669-44848691 GAAGAGGCCAGCGGCACCCAGGG + Intronic
1081659692 11:44880406-44880428 GATGAGGAGAGGGAGTCCCAGGG - Intronic
1081734354 11:45392866-45392888 GGGGAGGCCAGGTTTTCCCAGGG + Intergenic
1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG + Exonic
1082790187 11:57341750-57341772 TAGGAGGCCAGGGACTTCCCAGG + Intronic
1083276931 11:61602119-61602141 AAAGAGGGAAGGGACTCCCAGGG - Intergenic
1083459228 11:62799708-62799730 CAGCAGGCGAGGGAATCCCAAGG - Intronic
1083651809 11:64208544-64208566 CAGGAGGCCAGGGACTGGCCCGG - Intronic
1084185061 11:67467254-67467276 AAGGAGGGCAGAGCCTCCCACGG + Intronic
1084539560 11:69777312-69777334 GAGGAGGCCAGGGCCTGCGGAGG - Intergenic
1085037442 11:73308726-73308748 GAGGAGGACACGGACACCCCCGG + Exonic
1085301706 11:75462614-75462636 GAGCAGGACAGAGGCTCCCAGGG + Intronic
1085986678 11:81796002-81796024 GAGGAGGCCTGTGTCTGCCATGG - Intergenic
1087226637 11:95608088-95608110 GAGGAGACCAGGGCTTCCCAAGG - Intergenic
1088028839 11:105221154-105221176 CAGGAAGCCAGGGACTCCAGTGG - Intergenic
1089639752 11:119839846-119839868 GAGGAGCCAAGGGGCTGCCAAGG + Intergenic
1090024821 11:123158497-123158519 GAGGAGGGCAGGTCCACCCAGGG - Intronic
1090240671 11:125179393-125179415 GAGCAGGGCAGGGCCTCCCTGGG + Intronic
1090938865 11:131370301-131370323 CAGGAGGCCAGGGAATGCCAGGG + Intergenic
1091798569 12:3310768-3310790 AACCAGGGCAGGGACTCCCAGGG - Intergenic
1096228083 12:49882051-49882073 GAGGAGGCCCCAGACCCCCAGGG - Intronic
1096410999 12:51377150-51377172 GAGGGGGCCGGGGTCTCCCCTGG - Intronic
1096906454 12:54941199-54941221 GGGGAGGCCAGGGAAAGCCAAGG - Intergenic
1099165393 12:79300420-79300442 CAAGAGGCCAGGGAATCCTAGGG - Intronic
1101589232 12:106111470-106111492 GAGGAGGGCAGGGATTCTCTTGG - Intronic
1101710058 12:107256778-107256800 GAGGATGTCAGAGATTCCCAGGG - Intergenic
1101815686 12:108144310-108144332 GAGGAAGACAGGTGCTCCCATGG - Intronic
1103468706 12:121162765-121162787 GAAGGGGCCAGGGACACCCAAGG - Intronic
1103815280 12:123650053-123650075 CTGGAGGCCAGTGACTCTCAAGG - Intronic
1104651292 12:130536279-130536301 CAGGAGGCCAGGGATAACCAGGG - Intronic
1104760457 12:131295036-131295058 ACGGAGTCCAGGGACTCCCCAGG - Intergenic
1104819321 12:131665749-131665771 ACGGAGTCCAGGGACTCCCCAGG + Intergenic
1104855466 12:131900464-131900486 AAGGAGGCCAGGTGCTCCCCAGG - Intronic
1104988555 12:132611276-132611298 GGGGAGGCCAGGGACAGCCCAGG + Intergenic
1105631024 13:22168594-22168616 GCGGGGGCCGGGGCCTCCCATGG - Intergenic
1105818876 13:24062351-24062373 CAGGAGGCCAGGGACTGACTGGG + Intronic
1106589347 13:31086191-31086213 GAGGAGGCCAAGGTGTACCAAGG - Intergenic
1107650280 13:42538041-42538063 GGGGAGGCCAGGGATTCTAAAGG - Intergenic
1110544109 13:76737342-76737364 GTGGAGGCCAGCGGCTCACAAGG - Intergenic
1112545589 13:100366263-100366285 GCGTAGTCCAGGGACACCCAGGG + Intronic
1113120183 13:106917403-106917425 GAGGGCCCCAGGGACTCCCTGGG + Intergenic
1113456022 13:110449685-110449707 GAGGTGACCCGGGATTCCCAGGG + Exonic
1113904553 13:113813144-113813166 CAGGGAACCAGGGACTCCCAGGG + Exonic
1113911816 13:113845242-113845264 CGGGAGGCCAGAGACGCCCACGG + Intronic
1114208870 14:20598915-20598937 AAGGAGGCCAGTGAGACCCATGG - Intronic
1114455506 14:22850986-22851008 GAGGAGGGCAGAAACCCCCAAGG - Intergenic
1119217203 14:72878142-72878164 AAGGTGGACACGGACTCCCAGGG - Intronic
1121393130 14:93593721-93593743 GAGGAGAAGAGGGACTGCCAGGG - Exonic
1121667935 14:95686600-95686622 GAATGGGCCAGGGCCTCCCAGGG + Exonic
1121791400 14:96702307-96702329 GGGGAAGGCAGGGGCTCCCAGGG - Intergenic
1122100824 14:99408466-99408488 AGGGAGTCCAGGCACTCCCAGGG + Intronic
1122407114 14:101507193-101507215 GAGGAAGCCAGAGACTGACAAGG + Intergenic
1122436483 14:101704595-101704617 GAGGAAGCCAGGAACCCCCCAGG + Intergenic
1122629221 14:103099659-103099681 GGGGAGGGCAGGGACCCCCATGG - Intergenic
1124141926 15:27084792-27084814 CAGGAGGCCAGGGTCTCCAGGGG + Intronic
1124158950 15:27252197-27252219 GAGGAGGCCAGGCCAGCCCACGG - Intronic
1125271346 15:37941911-37941933 GAGCAGGGCAGGAATTCCCAGGG - Intronic
1126680089 15:51193760-51193782 GAGGAGCCCAGAAATTCCCAAGG + Intergenic
1127606369 15:60592009-60592031 GAGGAAGCCGGGGACGCCCGCGG - Intronic
1128803571 15:70513819-70513841 GAGGAGGCCCAGAAATCCCAGGG - Intergenic
1129084525 15:73074757-73074779 AAGGAGGCCAGGGACTCCTGGGG - Intronic
1129742424 15:77995878-77995900 GTGGAGGCCAGGGACCTTCAGGG + Exonic
1129747793 15:78037174-78037196 GAGGAGGCCAGGGACTCCCAGGG - Intronic
1129843059 15:78755599-78755621 GTGGAGGCCAGGGACCTTCAGGG - Intergenic
1129888401 15:79054887-79054909 GAGGTGGCCAGGGAAACCCCTGG + Intronic
1132516323 16:367804-367826 GGTGAGGCCAGGGAAGCCCAGGG + Intronic
1132549524 16:548571-548593 CAGGAGGCGAGGGCTTCCCAGGG + Intronic
1132688238 16:1171168-1171190 GGGCAGGGCAGGGACTTCCAGGG - Intronic
1133229804 16:4361114-4361136 GGGGTGGCCAGTGTCTCCCAAGG - Intronic
1135068675 16:19333339-19333361 GAGGAACCCAGGTCCTCCCATGG - Intergenic
1135486483 16:22870162-22870184 GAGGAGGGCAGCGTATCCCAGGG - Intronic
1135698365 16:24610231-24610253 GAGGCGGCATGTGACTCCCAGGG + Intergenic
1136175127 16:28511374-28511396 GAGCAGGCCAGTGACTCCCCTGG - Intronic
1136448681 16:30339894-30339916 GCGGAGGGCAGGCACTCACAGGG + Intergenic
1137716948 16:50603856-50603878 GAGCAGGGGAGGGGCTCCCAGGG + Intronic
1138217630 16:55218431-55218453 GAGGAGGCAGGGAACGCCCAAGG + Intergenic
1138947752 16:61872743-61872765 GAGGAGGGCAGGTACTCAGATGG + Intronic
1139322052 16:66122723-66122745 GAGGTGGGCAGGGACTTCCGGGG + Intergenic
1140485383 16:75289252-75289274 GTGGAGTCCAGAGACTCCCCTGG - Intergenic
1141430610 16:83968769-83968791 GCGGGGGCCAGCGACTCCCGGGG - Exonic
1141705888 16:85664274-85664296 GAGGAGGCCAGGGGCCCACGAGG - Intronic
1142047181 16:87932969-87932991 GCGGAGGGCAGGCACTCACAGGG - Intronic
1142149195 16:88505307-88505329 GAGGAGGCCAGTCCCTCCCCAGG + Intronic
1142205571 16:88781400-88781422 GAAGGGGCCAGGGACTGCCCAGG - Intronic
1142305857 16:89285052-89285074 GAGGATGACAGGGACTCTCTGGG - Exonic
1142447579 16:90151392-90151414 GAGGAGGCCAGGGAGTTGCTGGG + Intergenic
1142459914 17:83931-83953 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
1143346172 17:6250749-6250771 GTGGAGTCCAGGGACGCCCTGGG + Intergenic
1143502716 17:7348386-7348408 GAGGTGGCCGGGGGCGCCCAAGG + Exonic
1143739945 17:8945200-8945222 TAGGAAGCCAGGGCCTGCCAGGG - Intronic
1146226753 17:31073628-31073650 CAGGAGACCAGGGCTTCCCATGG + Intergenic
1146650566 17:34603684-34603706 GGGGAGGACAGGAACACCCAGGG - Intronic
1146675838 17:34773336-34773358 GTGGTGGCCAGGGACTCCTCAGG + Intergenic
1146912401 17:36657176-36657198 GAGGAGGAAAGAGAGTCCCAAGG - Intergenic
1147153660 17:38532566-38532588 CAGGAGGCCAGCGCCTCCCCAGG + Exonic
1147572311 17:41579055-41579077 GGGGATGCCAGGGACTTCCAGGG - Intergenic
1147863578 17:43538435-43538457 AAGGAGGGGAGGGATTCCCAAGG + Intronic
1148123066 17:45223526-45223548 GAGGAGGGCAGGGACACTGAGGG + Intronic
1148441032 17:47711679-47711701 CAGGAGGCCAGGGGGTCCCCAGG + Exonic
1148740701 17:49890835-49890857 CAGGAGGCCAGCGAGTCCCCCGG - Intergenic
1148785072 17:50142253-50142275 GAGAAGGCCTGGAGCTCCCAGGG - Intronic
1150280791 17:63928781-63928803 CTGGAGGCCAGGGCCTCCCTGGG + Exonic
1151976573 17:77487042-77487064 GAGGAGCCCAGGGCTGCCCAGGG - Intronic
1152583422 17:81178922-81178944 GGGGAGGCCAGGCACTGCTAAGG + Intergenic
1152585401 17:81187297-81187319 GAAGAGGCCTGGGACACTCATGG - Intergenic
1153117315 18:1675324-1675346 TGGGAGGCCAAGGCCTCCCAAGG + Intergenic
1153684166 18:7528735-7528757 AGGGAGGCCAGAGACACCCATGG + Intergenic
1154217913 18:12429037-12429059 CAGGAGGCCAGGAAAGCCCAGGG - Intronic
1154472860 18:14721883-14721905 GAGGAGGCCAGGGAGTAGCTGGG + Intergenic
1156468676 18:37363865-37363887 GAGGAGGCCAGAGAGTACCCAGG - Intronic
1157312214 18:46560731-46560753 GATGGGGCCAGGTAATCCCAGGG - Intronic
1159603978 18:70455912-70455934 GAGTAGGGCAGTGACTCACAAGG + Intergenic
1160387185 18:78503785-78503807 GTGGGAGCCAGGGGCTCCCAGGG + Intergenic
1160573261 18:79832670-79832692 GAGGAGACCTGGGACTGCCCAGG + Intergenic
1160649629 19:216439-216461 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
1160694778 19:478209-478231 CAGGACCCCAGGGGCTCCCACGG + Intergenic
1160809342 19:1006683-1006705 GAGCAGGCCAGGCACCCCCAGGG - Intronic
1160860939 19:1237033-1237055 GGGGAGGCCCGGGAATCGCAGGG + Intronic
1161048344 19:2149210-2149232 GAGGAAGCCTGGGACTTTCAAGG + Intronic
1161168552 19:2801747-2801769 GAGGCGGCCAGGGTGTCACATGG + Intronic
1161354321 19:3810596-3810618 GGGGACCTCAGGGACTCCCACGG + Intronic
1161591949 19:5132954-5132976 GTGGAGGCCCAGGTCTCCCATGG - Intronic
1161597181 19:5156508-5156530 GAAGCTCCCAGGGACTCCCAGGG + Intergenic
1161724222 19:5919078-5919100 CAGGAGGACGTGGACTCCCATGG - Intronic
1161777754 19:6273043-6273065 AAAGAGGGCAGGGACTCCCTAGG + Intronic
1161865919 19:6832197-6832219 GAGGAAGACGGGGACTCACATGG - Exonic
1162084237 19:8238727-8238749 GAGGAGGCTGGGGATACCCAGGG + Intronic
1162493262 19:11007836-11007858 GAGGGGGGACGGGACTCCCATGG - Intronic
1162802816 19:13120263-13120285 GAGGAGGCCTGGCACCACCAGGG + Intronic
1163225292 19:15956436-15956458 TAGGAGGCCAAGGAATCCCAGGG + Intergenic
1163441306 19:17323847-17323869 GCGGAGGGCAGGGGCGCCCACGG + Exonic
1164572823 19:29386490-29386512 GATGAGACCAGGGAATCCCGGGG + Intergenic
1164808892 19:31140613-31140635 GAGGTGGACGGGGACTCCAAAGG + Intergenic
1165407360 19:35639016-35639038 GAGGAGTGGAGGGTCTCCCAGGG + Intergenic
1165700578 19:37933958-37933980 GGGGAGGCCAGGGAGTGCCTGGG + Intronic
1166355399 19:42224527-42224549 GATGAGGCAAGGGCCTCCCCAGG - Exonic
1166495673 19:43301522-43301544 GAGGGAGCCAGAGACACCCATGG + Intergenic
1166705502 19:44905901-44905923 CTGGAGGCCAGGGGTTCCCAGGG - Intronic
1166750632 19:45162577-45162599 GGGGAGGCCAGACACCCCCATGG - Intronic
1167253019 19:48410960-48410982 GAGGAGTCCAGGGACACCCCCGG + Intronic
1168254445 19:55157972-55157994 GGAGTGGCCAGGGTCTCCCAGGG - Intronic
1168683629 19:58334881-58334903 GAGGAAGCCAGCCTCTCCCAGGG + Exonic
925620942 2:5791939-5791961 GAGGTGGCCAGGCACCTCCATGG + Intergenic
925934029 2:8735815-8735837 GAGGAGGCCAGCGGCTCTGAGGG + Intronic
925988039 2:9231678-9231700 GCAGATGCCAGGGACACCCAAGG - Intronic
926005366 2:9369422-9369444 GAGGTGGACAGGGAGACCCATGG + Intronic
926055223 2:9770463-9770485 GAGGAGCCCAGGGACTGCATGGG + Intergenic
926079540 2:9973204-9973226 GAGGAGACCAGCCTCTCCCAGGG - Intronic
927431191 2:23027583-23027605 GAGGGAGCCAGGCACTGCCAGGG - Intergenic
928904675 2:36356428-36356450 GAGGAGCCCAGGAACTGCCCGGG + Exonic
928938056 2:36701165-36701187 GTGGAGGCAAGGAACTCACAGGG + Intronic
929075111 2:38074460-38074482 AAGGCGGCCGGGGACTCGCACGG - Exonic
929763521 2:44825558-44825580 GAGGAGCCCAGGGGGTCTCACGG + Intergenic
931570887 2:63668206-63668228 GAGATGGCCAGGGACAGCCAGGG - Intronic
931628965 2:64282623-64282645 GAGGAGAGCAGGGTCTCCCCTGG + Intergenic
932573109 2:72948643-72948665 GAGGAGGCCTCGGTCTCCCCCGG - Intronic
933355199 2:81200779-81200801 GAGGATGACAGGGACTCCATGGG - Intergenic
933760454 2:85668554-85668576 GAGGGGGCCTGGGAGGCCCAGGG - Intronic
934692724 2:96374154-96374176 GAGGAGGAAACGGACACCCAAGG + Intergenic
935205777 2:100895592-100895614 GAGGAGGGCTGGAACTCCTAAGG - Intronic
937126526 2:119478353-119478375 CAGGAGGCCAGGGGCTCCCAGGG + Intronic
938310612 2:130286185-130286207 GGGGAGGCCAGGGAGTCTCCAGG - Intergenic
939617861 2:144380551-144380573 CAGGAGGCCTCGGGCTCCCACGG + Intergenic
942127572 2:172842633-172842655 GAGGAAGCCAGGCAGTCACATGG - Intronic
944985622 2:205172357-205172379 GAGGAGGCCAGAGAGACCAATGG + Exonic
946405566 2:219490314-219490336 GAGGAGAGCAGGGACCCCTAGGG - Intronic
946771307 2:223091954-223091976 GAGGAGGACAGGGAGTCACCAGG - Intronic
947529449 2:230899490-230899512 GGGGAGCCCAGGGAAGCCCAGGG - Intergenic
947602933 2:231465384-231465406 GAGGCCGCCAGTGACTTCCACGG + Intronic
947634367 2:231672734-231672756 GAGGAGACGAGGGGCCCCCACGG + Intergenic
948089148 2:235277692-235277714 GAGGAGGCCCCAGACTCCCAGGG - Intergenic
948145927 2:235707990-235708012 AAGGAGGCCAGGCACACCCTGGG - Intronic
948670225 2:239563815-239563837 GGGGAGGCCGTGGAGTCCCAGGG + Intergenic
1168835260 20:873382-873404 GAGGAAGACAGGGACGCCAAGGG - Intronic
1169426318 20:5500181-5500203 CAGGAGGACAAGGACTGCCAAGG + Intergenic
1169694728 20:8374498-8374520 GGGGAGGCCAGGAGCTGCCAAGG - Intronic
1169863298 20:10173682-10173704 AATGATGCCAGGGACTCCCAAGG + Intergenic
1170504915 20:17015006-17015028 GAGTAGGTCAGGATCTCCCAGGG - Intergenic
1171174954 20:23044808-23044830 GAGGAGGACAGGGAAGCTCAGGG + Intergenic
1172011991 20:31850932-31850954 GAGGAGGCCTGTGACTCCTCAGG + Intronic
1172033143 20:31995528-31995550 GAGGAGGGCAGGAGCGCCCAGGG - Intronic
1173575580 20:44111196-44111218 GAGGATCCCAGGGACCCCAAAGG - Intergenic
1174078867 20:47957100-47957122 GTGGAGGCCAGGGGCTCCAGGGG - Intergenic
1174160462 20:48546843-48546865 GTGGAGGCCAGGGACTCTTGTGG - Intergenic
1175357828 20:58382900-58382922 GAGGTGGCCACGGACTCCTGAGG - Intergenic
1175673906 20:60930941-60930963 CAGAGGGCCAGGGACTCTCAGGG - Intergenic
1175897850 20:62347269-62347291 GTGGAGGACAGGGTCTCACAGGG + Intronic
1176019909 20:62957268-62957290 GAGGAGACCAGGTACTCCAGGGG - Intronic
1176027640 20:62993960-62993982 CAGGTGGGCAGGGAATCCCAGGG + Intergenic
1176165687 20:63672277-63672299 GCGGTGGCCGGGGGCTCCCAGGG + Intronic
1176227765 20:64011785-64011807 GAGGAGGACAGGAAGTCTCATGG + Intronic
1176227770 20:64011844-64011866 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227775 20:64011903-64011925 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227780 20:64011962-64011984 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227785 20:64012021-64012043 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227790 20:64012080-64012102 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227795 20:64012139-64012161 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227800 20:64012198-64012220 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227805 20:64012257-64012279 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227810 20:64012316-64012338 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227815 20:64012375-64012397 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227820 20:64012434-64012456 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227825 20:64012493-64012515 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227830 20:64012552-64012574 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227835 20:64012608-64012630 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227840 20:64012667-64012689 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227845 20:64012726-64012748 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227850 20:64012785-64012807 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227855 20:64012844-64012866 GAGGAGGACAGGAAGTCTCATGG + Intronic
1176227860 20:64012903-64012925 GAGGAGGACAGGAAGTCTCATGG + Intronic
1176801624 21:13435966-13435988 GAGGAGGCCAGGGAGTAGCTGGG - Intergenic
1178508833 21:33185238-33185260 GAGGAAGCCAGGCAGCCCCATGG + Intergenic
1178785724 21:35651575-35651597 TAGGACCCCAGGGAATCCCAAGG + Intronic
1178952878 21:36999528-36999550 AAGGAGGCTAGGGAATGCCACGG + Intergenic
1179076119 21:38123478-38123500 GAGGAGGGCAGGGAGTCTGAAGG - Intronic
1179410832 21:41161938-41161960 GAGGAGGACAGTGTCCCCCAAGG - Intergenic
1179542449 21:42092272-42092294 GAGGAGGCTGTGGACTCCCAGGG + Intronic
1179646526 21:42779427-42779449 CAGCAGGGCAGGGAGTCCCAGGG - Intergenic
1179658939 21:42862581-42862603 GAGGTGGCCAGGGACCCTCTGGG - Intronic
1179727166 21:43347075-43347097 GAGGGGGCCAGGGACCACCCAGG + Intergenic
1180169466 21:46050401-46050423 GAGGATGCCAAGGGCTGCCAGGG - Intergenic
1180880908 22:19202884-19202906 GAGGGGGTCAGGGACATCCATGG - Intronic
1181325083 22:22038711-22038733 GAGGAGCCCTGGGAAGCCCAAGG + Intergenic
1181688561 22:24545435-24545457 GAGGAGGAGAGAGACACCCAAGG - Intronic
1182489656 22:30662940-30662962 GAGGTGGCCTGGGACCCCCCAGG + Exonic
1183478473 22:38050173-38050195 GAGGGGGCCAGTGACACCCAAGG + Intergenic
1184101198 22:42342581-42342603 GAGGAGGCAGGGGCCTGCCAAGG + Intronic
1184767758 22:46580480-46580502 GAGGAGGCCTGGATCTCCCAAGG + Intronic
1184776691 22:46626958-46626980 GACGAGGACAGGTACTCACAGGG - Exonic
1184871032 22:47238636-47238658 TAGGGGGCCAGGGACCCTCAGGG - Intergenic
1185077716 22:48692098-48692120 GAGGAGGCTAGGGTCTTCCTGGG + Intronic
1185134658 22:49062766-49062788 GAGGAGGCCAGGGCCTGGCAAGG + Intergenic
950404943 3:12798387-12798409 CAGGAGCTCAGGGTCTCCCAGGG - Intronic
950798166 3:15528160-15528182 GGGAAGGCCAGGGACTTCCGAGG + Intergenic
950962511 3:17120579-17120601 GAGGAGGCCAGGGAGACCTCAGG - Intergenic
952075016 3:29685485-29685507 GAGGATGGAATGGACTCCCATGG - Intronic
952736231 3:36694109-36694131 GAGCAGGCAAGGGAGTCCCTGGG - Intergenic
953840167 3:46383615-46383637 GTGGAGGCCAGGGATGGCCAGGG + Intergenic
953962076 3:47273933-47273955 GAGAAGGACAGGGAATCTCAGGG + Intronic
954376202 3:50195353-50195375 GTTGGGGCCAGGGAGTCCCAGGG - Exonic
954916215 3:54150441-54150463 GAGAAGGGCAGGGACTCCACAGG + Intronic
955393326 3:58536795-58536817 GAGGAGGACAGGGAATGCCGGGG - Intronic
957637354 3:82803598-82803620 CAGGAGGCCAGTGAATCCAATGG - Intergenic
958859551 3:99429846-99429868 GAGGAGACCGGAGACTCCAAAGG - Intergenic
961863089 3:129933691-129933713 CAGGAGGCCAAGGACCCCAAGGG - Intergenic
962703569 3:138022127-138022149 AAGGAAACCACGGACTCCCAAGG + Intronic
963204018 3:142614391-142614413 GAGGATGGCAGGGAATCACAAGG + Intronic
964489977 3:157226013-157226035 AAGGAGGACAGGGACTACAAGGG - Intergenic
964695647 3:159504899-159504921 GAGGATGCCAGGGATGCCCATGG + Intronic
966225372 3:177591783-177591805 GAGCAGGGCAGTGGCTCCCAAGG + Intergenic
966681100 3:182642954-182642976 GAGGAGGGAAGGGACTGCCAAGG + Intergenic
966881966 3:184355577-184355599 GAAGAGGCCATGGGATCCCACGG + Intronic
967357300 3:188586675-188586697 GAGGAGGGGAGAAACTCCCAGGG - Intronic
967730780 3:192904879-192904901 GCGGAGCCCAAGGCCTCCCAGGG - Intronic
968368220 3:198203692-198203714 GAGGAGGCCAGGGAGTTGCTGGG + Intergenic
968503206 4:960667-960689 GAGGAGGGCCGGGACCACCAGGG - Exonic
968757538 4:2424634-2424656 CAGGAGGGCAGGGGCTCCCGGGG - Intronic
969349064 4:6587646-6587668 TACCAGGCCTGGGACTCCCAAGG - Intronic
969681243 4:8644625-8644647 GAGGAGGCCAGGGAGCCACCAGG - Intergenic
969965987 4:10995928-10995950 TAGGTGGCCAAGAACTCCCAGGG + Intergenic
970188080 4:13484012-13484034 GAGGAGGCCGGGGACCGCCGGGG + Intronic
971231028 4:24800261-24800283 GCGGCGGCCAGGGACCCCCGAGG + Exonic
972738484 4:41867363-41867385 GAGCAGGCCAGGCGCACCCAGGG - Intergenic
973741989 4:53927295-53927317 GAGGAGGGTCTGGACTCCCAGGG + Intronic
974025213 4:56727600-56727622 GAGGAGGTCAGGGAAAGCCAGGG + Intergenic
975580254 4:75900547-75900569 GATGAGACCAGGGAGCCCCAAGG - Intronic
977059879 4:92244291-92244313 CAGGAGGCCAGGGCCACCTATGG - Intergenic
979258209 4:118625762-118625784 GAGGAGGCCAGGGAGTTGCTGGG + Intergenic
979330140 4:119414806-119414828 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
982130385 4:152224075-152224097 GAGGAGCCCAGTGACCCACATGG + Intergenic
982397166 4:154925322-154925344 GAGGTGGCTAGAGACCCCCATGG + Intergenic
983043796 4:162960769-162960791 AAGGAAGCCAGGGACTCAGATGG - Intergenic
984734908 4:183099540-183099562 GAGGAGGCCAGGGACTACGACGG + Exonic
985163060 4:187063837-187063859 GAGGAGGCCAGTGTCTTCCGCGG - Intergenic
985567594 5:628308-628330 GAGGAGGTGGGGGACGCCCAAGG + Intronic
985572894 5:659699-659721 GAGGAAGCGAGAGACTCCCTCGG + Intronic
985578289 5:683825-683847 GAGAAGACCAGGGACCGCCAAGG - Intronic
985593219 5:775965-775987 GAGAGGACCAGGGACCCCCAGGG - Intergenic
985614126 5:909368-909390 GAGAATGCCAGGGACTCCCCAGG - Intronic
985826240 5:2193593-2193615 GAAAAGGCCAGGCTCTCCCACGG + Intergenic
985874984 5:2587508-2587530 GATGAGGCCAGGCCCACCCAGGG - Intergenic
986347312 5:6846855-6846877 GAAGGGGCCAGGGAGCCCCAGGG - Intergenic
986506517 5:8457737-8457759 GCGCAGGCCAAGGACGCCCATGG - Intergenic
987357563 5:17078092-17078114 GAGGAAGCCAGAGAATCACACGG + Intronic
988066477 5:26232678-26232700 TACGTGGCCAGGGACTCCCTAGG - Intergenic
988542490 5:32123365-32123387 CAGGAGGCCAGGGACTTTCCTGG + Intergenic
990042633 5:51391282-51391304 GGGGATGACAGGAACTCCCATGG + Exonic
995922474 5:117330455-117330477 GTGGAGGCTAAGGAGTCCCACGG - Intergenic
997600255 5:135134113-135134135 GAGGGAGCCACCGACTCCCAGGG - Intronic
997642580 5:135459060-135459082 GAGGAAGCCAGGGTCTCTCTGGG - Intergenic
999192369 5:149757873-149757895 ATGGAGGCCTTGGACTCCCATGG + Intronic
999323728 5:150630448-150630470 GAGGAGGCCAGGGCCACCTTAGG - Intronic
1000352616 5:160363813-160363835 GTGGAGACCAAGGACTGCCATGG + Intronic
1001206660 5:169769658-169769680 GAGGAGGCCAGGGATGTGCATGG + Intronic
1001426758 5:171627986-171628008 CAAAAGGCCAGGGACTCCCAGGG - Intergenic
1002170611 5:177372159-177372181 GAAGGGGCCAGGGACACTCATGG - Exonic
1002307783 5:178293903-178293925 GAGGAGGCCACGGAGTCCAGAGG + Intronic
1002577082 5:180180064-180180086 GAGCAGGCCACCGCCTCCCAGGG - Intronic
1002727441 5:181308923-181308945 GAGGAGGCCAGGGAGTTGCTGGG + Intergenic
1003561579 6:7185035-7185057 GAGCTGGCCAAGGACCCCCATGG - Intronic
1004237129 6:13883927-13883949 CAGGAGGGCAGAGATTCCCAAGG + Intergenic
1005580932 6:27233911-27233933 GAGTAGGCCAGGGATTCAGATGG - Intergenic
1005582813 6:27250471-27250493 GACGAGGACAGGGTCTCCCTTGG + Intronic
1005706868 6:28463879-28463901 GAGGATGACAGGAACTTCCAAGG + Intergenic
1006220671 6:32487819-32487841 GAGCAGGCAAGGGAGTCCCTGGG + Intergenic
1006565902 6:34956951-34956973 GAGGAGGCCAGGGACGGGGAGGG - Intronic
1007213811 6:40220266-40220288 GTGAAGGCCAGGGACATCCATGG + Intergenic
1010806752 6:80246304-80246326 GGGGAGGCGAGGGACGACCAGGG - Intronic
1012691142 6:102312705-102312727 GATGTGTTCAGGGACTCCCATGG - Intergenic
1012767069 6:103381197-103381219 AAAGAGGCCAGGGACTCCTAAGG - Intergenic
1016750406 6:147625179-147625201 GAAGGGCCCAGGGTCTCCCAGGG + Intronic
1017324360 6:153130001-153130023 CCGGAGCCCAGGGACTCCCGAGG + Intronic
1017812602 6:157994868-157994890 GAAGACCCCAGGGAGTCCCAGGG + Intronic
1018197647 6:161368902-161368924 GAGAAGGGCAGGAACTCCAAGGG - Intronic
1018538990 6:164856376-164856398 GAGCAGGACAGGGATTCCCCTGG + Intergenic
1018792212 6:167157418-167157440 GACGAGGCCCGAGACCCCCAGGG + Exonic
1018812312 6:167306993-167307015 GAGGAGGCCACAGACCCCCCAGG - Intronic
1019279667 7:193398-193420 GAGGCGGCCGGGGGCTCCCCGGG - Exonic
1019291078 7:250602-250624 TAGGAAGCCCTGGACTCCCAGGG - Intronic
1019368122 7:645727-645749 GGAGAGGCCTGGGGCTCCCAGGG + Intronic
1019732078 7:2634001-2634023 GCAGAAGCCAGGGCCTCCCAGGG - Intronic
1019812628 7:3175637-3175659 GAGGCGACCAGTGACCCCCAGGG - Intergenic
1021690025 7:23222566-23222588 GAAGAGGCAAGGGACAGCCAGGG + Intergenic
1021959726 7:25859336-25859358 GAGGAGGCCAGGGAGTGAAATGG + Intergenic
1022134283 7:27432513-27432535 GGAGAGGCCAGTGATTCCCAAGG - Intergenic
1022391363 7:29947250-29947272 GAGAAGGTCATGGGCTCCCAGGG - Intronic
1022593625 7:31690135-31690157 GAGGAGGCCTGGACCTCCCGTGG + Intronic
1022943237 7:35258535-35258557 GAGGAGGCCCGGGGCTCTGAGGG - Intergenic
1023400194 7:39787056-39787078 GAGGAGGCCAGGGAGTTACTGGG + Intergenic
1024073122 7:45802807-45802829 GAGGAGGCCAGGGAGTTACTGGG + Intergenic
1024472236 7:49775715-49775737 AAGCAGGCCTGGGTCTCCCAGGG + Exonic
1024570352 7:50718031-50718053 GAGGAGGCCAGGGACTCAGTCGG + Intronic
1024619592 7:51146306-51146328 GAGGTGGCAAGGGAGCCCCAAGG - Intronic
1024650209 7:51397381-51397403 GAGGAGGCCAGGGAGTTACTGGG - Intergenic
1024651814 7:51409994-51410016 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
1025054356 7:55753030-55753052 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
1025132406 7:56383183-56383205 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
1025134024 7:56395775-56395797 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
1025183466 7:56837637-56837659 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
1025688459 7:63739330-63739352 GAGGAGGCCAGGGAGTTGCTGGG + Intergenic
1025910001 7:65820595-65820617 GAGGAGGCCAGGGAGTTGCTGGG + Intergenic
1025911572 7:65832825-65832847 GAGGAGGCCAGGGAGTCGGTGGG + Intergenic
1025978077 7:66385451-66385473 GAGGAGGCCAGGGAGTTGCTGGG - Intronic
1026794946 7:73359994-73360016 GGGGAGGGCAGGCACTTCCAGGG - Intergenic
1026836915 7:73645721-73645743 GAGGAGGACAGGGCTTGCCAAGG + Intergenic
1027203658 7:76080115-76080137 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
1029514834 7:101018143-101018165 GGGGAGGGGAGGGAGTCCCAGGG - Intronic
1031808444 7:126336185-126336207 GAGGAGGCCCAAGACTCCCAAGG - Intergenic
1032048960 7:128634186-128634208 GAGGAGGCCAGGGAGTTGCTGGG + Intergenic
1032050509 7:128646501-128646523 GAGGAGGCCAGGGAGTTGCTGGG + Intergenic
1032173487 7:129605418-129605440 GAGGAGGCCTAGGACTGCTAAGG - Intergenic
1032431013 7:131861597-131861619 GAGCAGGCCAGTGCCTCCCATGG + Intergenic
1033332579 7:140428665-140428687 GAGGATGCCAGGAAGTCCAAGGG - Intergenic
1033741876 7:144282402-144282424 GAGGAGACCAGGGCCTTCCGAGG + Intergenic
1033752025 7:144367212-144367234 GAGGAGACCAGGGCCTTCCGAGG - Exonic
1034201514 7:149285623-149285645 GAGGAGGACAAGGACTCCTAAGG + Intronic
1034264866 7:149776040-149776062 GAGGAGGGCAGGGAGTAGCATGG - Intergenic
1034310630 7:150084743-150084765 AAGGAGGCCAGGTACTCCAGGGG + Intergenic
1034423728 7:151002141-151002163 GAGGAGGGCAGGGCCTCCGGGGG + Intronic
1034796207 7:154015886-154015908 AAGGAGGCCAGGTACTCCAGGGG - Intronic
1034892328 7:154852301-154852323 CAGGATGCCATGGACTCACAAGG - Intronic
1035132631 7:156669713-156669735 GGGCAGGGCTGGGACTCCCAGGG + Intronic
1036425339 8:8640511-8640533 CAGGAAGCCAGGAACACCCATGG + Intergenic
1036796248 8:11758534-11758556 AAGGAGGCCCTGGGCTCCCAGGG + Exonic
1038530977 8:28317705-28317727 GAGGGGGCCAGGGTCTTCCTGGG - Intronic
1040111981 8:43570686-43570708 GAGGAGGCCGGGGTCCCACATGG - Intergenic
1040387142 8:46921280-46921302 CTGGAGGCCAGGGGCTCCCCTGG + Intergenic
1040532038 8:48274093-48274115 GAGGAGGGCAGGGAGCCCCTGGG + Intergenic
1040633918 8:49249812-49249834 TAGCAAGCCAGGGACTCCCAGGG - Intergenic
1041388916 8:57331896-57331918 GAAGAGGACAGGGCCTCCTAGGG - Intergenic
1043359292 8:79452061-79452083 GAGAAGGTCAGGGACTACCTGGG + Intergenic
1044551927 8:93522051-93522073 GAGAGGGCCAGGTAGTCCCAAGG - Intergenic
1044795434 8:95892351-95892373 AAGGAGGTCAGGGACTGGCATGG - Intergenic
1045075566 8:98562976-98562998 TAGGAGGTCAGGGGATCCCAGGG + Intronic
1045350011 8:101329908-101329930 GAGGGGGCCAGGTACTCCTGGGG - Intergenic
1045424949 8:102056570-102056592 GAGGAGGCCAGGCTGTCCCATGG + Intronic
1045547269 8:103140528-103140550 GAGGAGGGCTGGGGCTCCCGAGG - Intronic
1047681482 8:127258349-127258371 GAGGAGGTTAGGGCTTCCCACGG + Intergenic
1048354597 8:133642849-133642871 GAGGAGGCCAGTGACTCATGAGG + Intergenic
1049007117 8:139862768-139862790 GGTGAGGCCAGGGGCTCCCCAGG + Intronic
1049099541 8:140569071-140569093 AGGGAGGCCAAGGGCTCCCAAGG - Intronic
1049291908 8:141807831-141807853 TTGGAGGCCTGGGGCTCCCATGG - Intergenic
1049624387 8:143613534-143613556 GTGGAGGCCATGGACTTCCATGG - Exonic
1049673300 8:143879040-143879062 GAGGGGACCAGGTACTCCCAGGG - Intergenic
1052257081 9:26469925-26469947 TAGGAGGTCAGAGAATCCCAGGG - Intergenic
1053482011 9:38423009-38423031 AAGGTGGCCAGTGAGTCCCAAGG - Intronic
1056308750 9:85319126-85319148 CAGGAGGCGCTGGACTCCCATGG - Intergenic
1056815288 9:89796679-89796701 GAGGAGGCCAAGTGCTCACAGGG + Intergenic
1057725482 9:97565164-97565186 GAGGAGGCTGGGGCCTCACAGGG - Intronic
1058704906 9:107630088-107630110 GTGAAGGCCAGGGACTCCAGTGG - Intergenic
1059457041 9:114406303-114406325 GAAGAGGACAGGGACCCCCAAGG + Intronic
1060785347 9:126448159-126448181 GAGGAGGACAGGAGCTGCCAGGG - Intronic
1061431920 9:130536554-130536576 GAGATGGCCAGTGACTCCCAGGG - Intergenic
1061909594 9:133715687-133715709 GGGGAGCCCAGGGACTTCCACGG - Intronic
1061933757 9:133846408-133846430 GTGGAGGCCAGGGCCACCGAGGG - Intronic
1061934358 9:133849244-133849266 GAGGAGGCCACTGACCCCGAAGG + Intronic
1062056852 9:134473214-134473236 GAGGGGGACTGGGCCTCCCAGGG - Intergenic
1062160809 9:135078703-135078725 GGGCAGGGCAGGGACTCCCTGGG + Intronic
1062279961 9:135747427-135747449 GCTGAGCCCAGGGTCTCCCAAGG - Intronic
1062430634 9:136525515-136525537 GAGGAGGCCATGCCCACCCAGGG - Intronic
1062566146 9:137164802-137164824 GTGGAGGCCACTGACCCCCAAGG - Intronic
1062574238 9:137199172-137199194 GAGGAAGCCAGGGACTCTGCAGG - Exonic
1062752561 9:138266397-138266419 GAGGAGGCCAGGGAGTTGCTGGG + Intergenic
1203575075 Un_KI270745v1:1172-1194 GAGGAGGCCAGGGAGTTGCTGGG + Intergenic
1185726399 X:2425535-2425557 GAGCCTGCCAGGGACTCACAGGG - Intronic
1189436437 X:40996928-40996950 GAGGAGCCCAGGAACCACCATGG - Intergenic
1190221380 X:48514422-48514444 GAGGAGGGCGGGTGCTCCCAGGG + Intronic
1190244718 X:48683698-48683720 GAGGAGGCCAGGCCCACCAAGGG + Intronic
1192263852 X:69525184-69525206 GAGGAGGGCAGGAACTCCACTGG + Intronic
1193773887 X:85620215-85620237 TAGGGGGTCAGGGACTCACAGGG - Intergenic
1193833922 X:86320114-86320136 CTGGTGGCCAGGGACTCCTAGGG - Intronic
1195758150 X:108219716-108219738 AAGAAAGCCAGGAACTCCCATGG + Exonic
1199515527 X:148670850-148670872 GCGGAGGACAAGGACTCCAAGGG - Intronic
1199618905 X:149681670-149681692 GAGCAGGCAAGGGAGTCCCTGGG - Intergenic
1200073745 X:153541284-153541306 TAGGAGGCCTGGGACACACAAGG + Intronic