ID: 1129749576

View in Genome Browser
Species Human (GRCh38)
Location 15:78052069-78052091
Sequence CTCTCCCCCAGCTCTGGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 601
Summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 545}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129749574_1129749576 -10 Left 1129749574 15:78052056-78052078 CCAGCAGTCTAGGCTCTCCCCCA 0: 1
1: 0
2: 2
3: 13
4: 149
Right 1129749576 15:78052069-78052091 CTCTCCCCCAGCTCTGGCTCTGG 0: 1
1: 0
2: 5
3: 50
4: 545
1129749570_1129749576 4 Left 1129749570 15:78052042-78052064 CCAAAATCCCAAGACCAGCAGTC 0: 1
1: 1
2: 2
3: 12
4: 173
Right 1129749576 15:78052069-78052091 CTCTCCCCCAGCTCTGGCTCTGG 0: 1
1: 0
2: 5
3: 50
4: 545
1129749569_1129749576 25 Left 1129749569 15:78052021-78052043 CCACTGCTCTTAGGTTAAAGTCC 0: 1
1: 1
2: 14
3: 70
4: 299
Right 1129749576 15:78052069-78052091 CTCTCCCCCAGCTCTGGCTCTGG 0: 1
1: 0
2: 5
3: 50
4: 545
1129749572_1129749576 -3 Left 1129749572 15:78052049-78052071 CCCAAGACCAGCAGTCTAGGCTC 0: 1
1: 0
2: 0
3: 13
4: 126
Right 1129749576 15:78052069-78052091 CTCTCCCCCAGCTCTGGCTCTGG 0: 1
1: 0
2: 5
3: 50
4: 545
1129749573_1129749576 -4 Left 1129749573 15:78052050-78052072 CCAAGACCAGCAGTCTAGGCTCT 0: 1
1: 0
2: 2
3: 13
4: 135
Right 1129749576 15:78052069-78052091 CTCTCCCCCAGCTCTGGCTCTGG 0: 1
1: 0
2: 5
3: 50
4: 545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129749576 Original CRISPR CTCTCCCCCAGCTCTGGCTC TGG Intronic
900517735 1:3091050-3091072 CTAACCCCGAGCTCTAGCTCTGG + Intronic
900570864 1:3357571-3357593 CTCTCCATCAGCACTGGCTGGGG - Intronic
900600149 1:3499380-3499402 CTCTCCCCTCCCTCTGGCTCAGG + Intronic
900748032 1:4374520-4374542 CTCACTTCCAGCTCTGGCCCTGG - Intergenic
900935782 1:5765598-5765620 CTCTGCCCCACCTCTGGCAACGG + Intergenic
900941158 1:5799434-5799456 CTCACTGCCAGCTCTGCCTCTGG - Intergenic
901028777 1:6293953-6293975 GTCTGCCCCTGCTCAGGCTCTGG + Intronic
901106151 1:6758214-6758236 GCCTCCCCCAGTCCTGGCTCTGG + Intergenic
901207182 1:7503929-7503951 CCCTCCCCCAGCCCTTCCTCTGG - Intronic
901215675 1:7553912-7553934 CTGCCCCCCTGCTCTGTCTCTGG + Intronic
901481821 1:9530428-9530450 CTCTGCCCCAGCTCTGAGTTAGG + Intergenic
902386538 1:16079141-16079163 CTCAGCCCCAGCCATGGCTCTGG + Intergenic
902707684 1:18217015-18217037 CCCTCCCCCTGCTGTGGGTCTGG - Intronic
903019991 1:20387036-20387058 CTCCCCCTCAGCCCTGCCTCGGG - Intergenic
903222841 1:21878480-21878502 CTCTCCCCTAGCTGTGCCCCCGG - Exonic
903466358 1:23554885-23554907 CTCTGGCTCCGCTCTGGCTCCGG - Intergenic
903896691 1:26610903-26610925 CTCTCCCAAATCTCGGGCTCTGG + Intergenic
904035235 1:27555496-27555518 CTCTCTCCCAGGCCTGGCTGTGG + Intronic
904566173 1:31429583-31429605 CCCTCCCCTCACTCTGGCTCAGG - Intronic
904615034 1:31744973-31744995 ATCTCCCCCACATCTGGCTGAGG - Intronic
904894045 1:33800755-33800777 CCCTCGCCCAGATCTGGCTGTGG - Intronic
904925288 1:34042859-34042881 CTCTCTCCAAGCTCTGCCTCCGG + Intronic
905517382 1:38571873-38571895 CTCTCCCTCAACTCTGTTTCAGG - Intergenic
906046502 1:42835057-42835079 CTCCCCCTCAGCAGTGGCTCTGG + Exonic
906056457 1:42921945-42921967 CTCTTTCCCAGCTCAGGCTTTGG - Intergenic
906203074 1:43972187-43972209 GTTTCCCACAGCTCTGACTCAGG - Exonic
910432436 1:87172516-87172538 TTCTGCCCCAGCTCTGGTCCAGG - Intergenic
910533048 1:88262994-88263016 GTCTCCTCCTACTCTGGCTCTGG + Intergenic
910825590 1:91404421-91404443 GTCCCCCCCAGCGCTCGCTCAGG + Intronic
911093556 1:94037287-94037309 CACTCCACCAGCTTTGCCTCTGG + Exonic
911102931 1:94108060-94108082 CTCTCCACTTGCTCTGCCTCGGG + Intronic
912454286 1:109787435-109787457 CTCTCACCCAGCCCTCTCTCTGG + Intergenic
912480032 1:109976185-109976207 CTCACCCCCAGCTCTACCTCAGG - Intergenic
912698863 1:111861425-111861447 CCCTCCCCCAGCCCAGTCTCAGG + Intronic
913341373 1:117760718-117760740 CCCCACCCCACCTCTGGCTCAGG + Intergenic
915310762 1:155004850-155004872 CACACCCCCAGCCCTGGCACAGG + Intronic
915517511 1:156421752-156421774 CTCTGCCGCGGCTCTGGCCCCGG + Intronic
915596998 1:156901671-156901693 CTGACCCTCAGCTCTGGCCCTGG - Intronic
915931437 1:160062886-160062908 ATCTCCACCTGCTCTGGTTCTGG + Intronic
916059080 1:161086628-161086650 CCCTCCCCCATCTCTTGCCCTGG - Intronic
916479224 1:165200384-165200406 CTCCCCCACAATTCTGGCTCAGG + Intergenic
916868553 1:168887408-168887430 CCCTGCCCCAGCCCTGGCTAAGG - Intergenic
917974302 1:180229548-180229570 CTCTCCCCCGCGTCTGGCTGAGG - Intergenic
919731112 1:200914109-200914131 TTCTCCCCCAGCCCAGGCTGGGG - Intronic
919748498 1:201023037-201023059 TTCACACCCAGCTCTGGCCCAGG - Intronic
920345097 1:205301378-205301400 AACGTCCCCAGCTCTGGCTCTGG - Intergenic
922465515 1:225843618-225843640 CACTCCTGCAGCTCTGGCCCCGG + Intronic
922534757 1:226371590-226371612 TTCTTCCCCAGATGTGGCTCCGG - Intronic
923347228 1:233066361-233066383 CTTTGTCACAGCTCTGGCTCAGG - Intronic
923471053 1:234291377-234291399 CTCTCCCCAAGCTCTAGCCAAGG - Intronic
924946469 1:248850186-248850208 CTCTCCTCCAGCTTTGGCTTTGG - Exonic
1062768236 10:81184-81206 CACTCCCCCAGCACAGGGTCTGG + Intergenic
1063901558 10:10738031-10738053 CTCTCACCCAGGTCTGCCACAGG + Intergenic
1064019328 10:11796580-11796602 CTCTTCCCCAGTTCTGGCAATGG - Intergenic
1064097063 10:12431649-12431671 GACGCCCCCAGCTCTGGCCCTGG - Intronic
1065511200 10:26480054-26480076 GTCACCCCCAGCTCCAGCTCAGG - Intronic
1065976413 10:30846524-30846546 CCCTGGCCCAGCTCTGCCTCAGG - Intronic
1067084476 10:43230535-43230557 CTCTCACCCAGCTCAGGTGCTGG - Intronic
1067208808 10:44241874-44241896 CTCCACCCCAGCTCTGGCCCAGG - Intergenic
1067450563 10:46379685-46379707 CTCCCCACAAGCTCTGGCTCTGG + Intronic
1067586680 10:47480066-47480088 CTCCCCACAAGCTCTGGCTCTGG - Intronic
1068358277 10:55940918-55940940 CTCTGAGCCAGCTCTGGCTTGGG - Intergenic
1068405622 10:56585151-56585173 CTCTCCCCCTTCTCAGTCTCCGG + Intergenic
1069557007 10:69405073-69405095 CGCTCCCCCAGGTTTCGCTCTGG - Exonic
1069842438 10:71348188-71348210 TTCTCCCCCAGCACAGGCACAGG - Intronic
1070782055 10:79143364-79143386 CTATCCCTCTGCTCTGGCTGAGG + Intronic
1070948428 10:80411812-80411834 TTCTCCCCTATCTCTGCCTCAGG + Intronic
1072432588 10:95386560-95386582 CTCACCCCAACCTCTGCCTCTGG - Intronic
1073060707 10:100731740-100731762 TTTTCCCCCAGCTCTTGCCCTGG + Intergenic
1073176721 10:101561420-101561442 CTCTCCCCCAGCTTTGGGGCTGG + Intergenic
1073901812 10:108231306-108231328 CTCTCCCTCAGCTCACACTCAGG - Intergenic
1074001454 10:109377796-109377818 CTCACCCCTAGCTTTGGCTAGGG + Intergenic
1074415364 10:113262707-113262729 CTCTTCCCCTCCTCTGGTTCTGG - Intergenic
1074641004 10:115380525-115380547 TTGTCCCCCAGCCCTGCCTCTGG + Intronic
1074979953 10:118611474-118611496 CTTTCCCCTAGCTCTGTCTCTGG - Intergenic
1075236736 10:120737276-120737298 CTGTCCCTCTGCTCTGGCACAGG - Intergenic
1075397097 10:122135203-122135225 CTCTCCCGCAGCTCTGCCAGTGG - Intronic
1075616050 10:123891620-123891642 CGCTACCCCAGCGCTGGCCCTGG - Exonic
1075806707 10:125194232-125194254 CCCTCTCCCAGCCCAGGCTCTGG - Intergenic
1075911523 10:126129230-126129252 CGCTCTCTCAGCTCTGACTCAGG - Intronic
1075999793 10:126905591-126905613 CTCGCCCCAAGCCCAGGCTCCGG + Intronic
1076110151 10:127854017-127854039 CTCTCCATCAGCTCTGACCCAGG + Intergenic
1076318773 10:129563650-129563672 CTCTCTCCCAGCACTGTCCCTGG - Intronic
1077058244 11:606300-606322 CTCCCCCACAGCCCTGGCTCCGG - Intronic
1077155464 11:1089060-1089082 TTGTCCTCCAGCTTTGGCTCTGG + Intergenic
1077183585 11:1226949-1226971 CCCCCCCCCAGCCCTGGCCCAGG - Intronic
1077284026 11:1757999-1758021 CCCTCCCCCAGCCCTGGATGAGG + Intronic
1077343264 11:2035439-2035461 GTCTCCCCCGGCCCTGGCCCCGG + Intergenic
1077343299 11:2035549-2035571 CTCTGCCCCAGCCCTGGCCCCGG + Intergenic
1077377657 11:2212783-2212805 CTCACTCCCAGCTCTGCCTGGGG + Intergenic
1077611599 11:3646290-3646312 CACACCCCCTGCCCTGGCTCAGG - Intronic
1077811480 11:5642274-5642296 TTCTCCCCCTCCTCAGGCTCAGG + Intronic
1078534559 11:12162635-12162657 CTCTCCCTCAACTTTGCCTCTGG - Intronic
1078551964 11:12287377-12287399 CTCCACCCCACCCCTGGCTCAGG + Intronic
1080781786 11:35436156-35436178 CTCTCACCCTGCTCTTTCTCTGG - Intronic
1081525328 11:43924323-43924345 CCGTCCCCCAGCCCTGGCCCTGG + Intergenic
1082729055 11:56772719-56772741 CACTACCCCATCTCAGGCTCTGG - Intergenic
1083547432 11:63559338-63559360 AGCTCCCACAGCACTGGCTCAGG - Intronic
1083613590 11:64015768-64015790 CAGTCCTCCAGCTCTGGCCCTGG - Intronic
1083614100 11:64018044-64018066 CTCACCCCCTCCTCAGGCTCTGG - Intronic
1083626260 11:64073613-64073635 TGCACCCCCAGCGCTGGCTCTGG - Intronic
1083641739 11:64149389-64149411 CACTGCCCCAGCCCTGGCCCTGG + Intronic
1083893272 11:65607519-65607541 CTCTCCACCATCGCTGTCTCGGG - Intronic
1084118249 11:67054366-67054388 CTGGCACCCAGCTGTGGCTCAGG - Intergenic
1084164772 11:67370416-67370438 CCCCGCCCCAGCTCTGCCTCTGG + Intronic
1084296658 11:68216539-68216561 CTCTCTAGCAGGTCTGGCTCTGG + Intergenic
1084409191 11:68996740-68996762 CGCTCGCCCTGTTCTGGCTCTGG + Intergenic
1084453287 11:69252510-69252532 CCTTCCCTCGGCTCTGGCTCGGG + Intergenic
1084474251 11:69379899-69379921 CTCACCGCCACCTCTGCCTCTGG + Intergenic
1084666800 11:70580725-70580747 GCCTGCCCCAGCCCTGGCTCTGG - Intronic
1084669373 11:70596226-70596248 CTCTGGCCCAGCCCTGGCCCAGG - Intronic
1084890161 11:72232817-72232839 ATCACCCCTGGCTCTGGCTCCGG + Intronic
1084955040 11:72686671-72686693 CTCTGGCCCTGCTCTGGCTCAGG + Intronic
1085266958 11:75242777-75242799 CCCACCCCCGCCTCTGGCTCAGG + Exonic
1086533501 11:87814805-87814827 CTCACCGCAAGCTCTGCCTCCGG + Intergenic
1088884334 11:113995091-113995113 TCCTCCCCCAGCTCCTGCTCCGG - Intergenic
1088884503 11:113996478-113996500 CCCTCCCCTAGCTCCTGCTCTGG - Intergenic
1089076859 11:115745394-115745416 CTCACTCCCAGCTTTGGCTGAGG - Intergenic
1089202304 11:116731810-116731832 CTCTCACCCAGTTCTAACTCTGG - Intergenic
1089402412 11:118171858-118171880 CTCAGCTCCAGCTGTGGCTCCGG - Intronic
1089561168 11:119343953-119343975 CCCTCCCCCAGCTCTGCACCTGG - Exonic
1089688236 11:120170216-120170238 CCCTCCCCCAGCCCCGCCTCTGG - Exonic
1090160226 11:124485018-124485040 CTCACCCTCAGCTCAGTCTCAGG + Intergenic
1090831324 11:130422576-130422598 CACACCCCCAGCTCAGTCTCAGG - Intronic
1091225711 11:133955809-133955831 GTCTCCCCCAGCTCAGACCCAGG + Intronic
1091360658 11:134976536-134976558 CTCTCTCCCATCCCTGGCCCGGG + Intergenic
1202826250 11_KI270721v1_random:90628-90650 GTCTCCCCCGGCCCTGGCCCCGG + Intergenic
1202826285 11_KI270721v1_random:90738-90760 CTCTGCCCCAGCCCTGGCCCCGG + Intergenic
1091967991 12:4761792-4761814 GTGTCCCTGAGCTCTGGCTCCGG + Intronic
1092180338 12:6442588-6442610 CTCTCCCCCATGCCTGGCTGGGG - Intergenic
1092247420 12:6871496-6871518 TTCACCCCCAGCTCTGACTAGGG - Intronic
1094282251 12:28753253-28753275 CTCTCCATCAGCTCTTGCTTTGG + Intergenic
1095406094 12:41869127-41869149 CTCTGCCCATGGTCTGGCTCTGG - Intergenic
1095690116 12:45078633-45078655 TTCTTCCTCAGCTTTGGCTCAGG - Intergenic
1096470147 12:51870434-51870456 CTTTCCCCCACCTCTGGCCTTGG + Intergenic
1096695218 12:53344657-53344679 CTCCCCCACAGCTGTGGCTGGGG - Intronic
1097033566 12:56106804-56106826 CCCCACCCCAGCTCTGGCTGAGG + Intronic
1097174573 12:57135437-57135459 CTCTCTCCCAGCTCTGAGTGAGG + Intronic
1098039287 12:66337787-66337809 CTAGCACCCAGCTCTGGGTCTGG - Intronic
1098712121 12:73775926-73775948 CTCTGAGCCTGCTCTGGCTCAGG + Intergenic
1101414072 12:104493645-104493667 CCTTCCCTCAACTCTGGCTCAGG + Intronic
1102063371 12:109952314-109952336 CTCTCCCCCAGCTCACACTCTGG + Intronic
1102340326 12:112116501-112116523 CTCTCCCCCAACACTGCCTAAGG - Intergenic
1102822852 12:115923267-115923289 GGCTTCCCCAGCCCTGGCTCCGG + Intergenic
1103479078 12:121239310-121239332 CACTCCCCTACCTGTGGCTCTGG + Exonic
1103516540 12:121512103-121512125 CTCTCCCCAGCCTCTGTCTCCGG + Intronic
1103521037 12:121537232-121537254 CTCCCGCCCCGCGCTGGCTCCGG + Intronic
1103967975 12:124652252-124652274 CTCTCCCCCAGGTCTGGGATGGG - Intergenic
1104950540 12:132437876-132437898 CTCAGCCTCAGCCCTGGCTCAGG - Intergenic
1105390341 13:19971342-19971364 CTCACCACCACCTCTGCCTCCGG + Intronic
1105453884 13:20523676-20523698 CACACACCCAGCTCTGCCTCTGG - Intronic
1105948558 13:25210029-25210051 CTGTCCCTCAGGTCTGGGTCTGG + Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1106378493 13:29212891-29212913 CTCTCCCCTTCCTCTGGCGCTGG - Intronic
1106621365 13:31374039-31374061 TTCCCTCCCAGCTCTGGCTAAGG + Intergenic
1106635021 13:31519400-31519422 CTCTTCCCCAGCTCTGCTGCTGG + Intergenic
1107236007 13:38171576-38171598 CTGTATCCCAGCTCTGGCACTGG - Intergenic
1108677099 13:52746503-52746525 CTCTCTCTCATCTCTGGCTAGGG - Intergenic
1109545907 13:63839023-63839045 CCCTCTTCCAGCTCTGGCTTAGG + Intergenic
1110760955 13:79229700-79229722 ATTTCTCCCAGCTGTGGCTCAGG + Intergenic
1112290923 13:98143442-98143464 CCCTCTCCCGGCTCGGGCTCCGG - Intronic
1113109559 13:106807750-106807772 CTCTCCCCCAGTTCTGACTGGGG - Intergenic
1115498131 14:34027037-34027059 CACTTCCCCAGCTCAGGCTCAGG - Intronic
1115533029 14:34344406-34344428 GTCTCTCTCAACTCTGGCTCAGG - Intronic
1117963930 14:61188397-61188419 CTCTCAGGCAGTTCTGGCTCCGG + Intronic
1118565948 14:67141169-67141191 CTGTCCACAAGCTCTGACTCTGG - Intronic
1118632907 14:67722575-67722597 TTCAACCCCAGCTCTGGCTCAGG - Exonic
1118667019 14:68081378-68081400 CTTTCCTCCAGCTGTGGCACAGG + Intronic
1118765080 14:68904216-68904238 CTATGCCCCAGCTCTGACTGGGG - Intronic
1119603698 14:75996013-75996035 TTCTCCGCCAGCACTGGCTCTGG + Intronic
1120475365 14:84979945-84979967 CTCTCCCCTTACTCTGTCTCTGG + Intergenic
1120528881 14:85608829-85608851 CTCTCCCCATGTTCTTGCTCAGG - Intronic
1120996825 14:90423740-90423762 CTTTCCTGCCGCTCTGGCTCAGG + Intergenic
1121050523 14:90816538-90816560 CCCTGCCCCAGCCCTGGCTCCGG - Intergenic
1121245115 14:92456557-92456579 GCCTCCACCGGCTCTGGCTCTGG - Exonic
1121485708 14:94312823-94312845 CTCCTCCCCAGCTCTCTCTCAGG - Intronic
1122151656 14:99729157-99729179 CTATGGCCCAGCTGTGGCTCTGG - Intergenic
1122278919 14:100609974-100609996 CCCTCCCCCAGCCCTGGGGCAGG - Intergenic
1122318313 14:100838553-100838575 ATCTCCACCCGCTATGGCTCAGG - Intergenic
1122323530 14:100869226-100869248 CCCACCCCCAGCCCTGGCCCAGG - Intergenic
1122323717 14:100870268-100870290 CCCACCCCCAGCCCTGGCCCAGG - Intergenic
1122632505 14:103113479-103113501 GCCTCCCCCAGCTCAGGCTGGGG + Intergenic
1122700072 14:103582258-103582280 ATGCCCCCCAGCTATGGCTCAGG - Intronic
1122710981 14:103657978-103658000 GTCTGCCCCAGCTTAGGCTCTGG + Intronic
1122776471 14:104119119-104119141 CCCTCCCTCAACTCTGCCTCTGG + Intergenic
1122854127 14:104552041-104552063 GGCTGCCCCAGCTCTGCCTCAGG + Intronic
1122864613 14:104597912-104597934 CGCTCCCCATGCTCTGGCCCTGG - Intronic
1122882833 14:104697697-104697719 CTCTCCCCTGACTCTAGCTCTGG - Intronic
1123000445 14:105291182-105291204 CTCTGGCCCTGCTCTGGCTCTGG - Intronic
1123436118 15:20255806-20255828 CTCACCCACAGCACTGGGTCTGG + Intergenic
1123705516 15:22948090-22948112 CCCTCCTCCAGCACTGGCGCAGG + Intronic
1124010631 15:25835885-25835907 CTCACTGCCAGCTCTGCCTCCGG + Intronic
1124581439 15:30958940-30958962 CTCTCCCCTAGCTCTGGTGCTGG - Exonic
1125612430 15:40980516-40980538 TTCTCCTCCAGCTCAGACTCTGG - Intronic
1125922596 15:43534380-43534402 CTCAACCACAGCTCTGGCACAGG + Exonic
1125986395 15:44057196-44057218 CTCACTGCCACCTCTGGCTCCGG + Intronic
1126379536 15:48031643-48031665 CCTTCCCCCATCGCTGGCTCAGG + Intergenic
1127637675 15:60887128-60887150 CTCTCTCTCAGCTCTGGCAAAGG - Intronic
1127901622 15:63345340-63345362 CTCTGCCCCACCTCTGGCCCTGG - Intronic
1128033245 15:64500107-64500129 TTCTCCCCTTCCTCTGGCTCCGG - Exonic
1128979897 15:72178647-72178669 CTCACTGCCAGCTCTGCCTCTGG + Intronic
1129387260 15:75202707-75202729 CTCTCCCCTCGCTCGGGCCCCGG - Intronic
1129413305 15:75361416-75361438 CTCTGCCTCAGCCCTGACTCTGG - Intronic
1129539101 15:76336701-76336723 CCCGCCCCCAGCTCCGGCCCGGG + Intergenic
1129749576 15:78052069-78052091 CTCTCCCCCAGCTCTGGCTCTGG + Intronic
1130113518 15:80986667-80986689 CTGGCCCCCCGCTCTGCCTCAGG - Intronic
1131206132 15:90449370-90449392 CTCTACCCCAGCTTTGGCAAAGG + Intronic
1131844968 15:96481202-96481224 CTCTCCGCCTACTCTGGCTCAGG - Intergenic
1132142833 15:99409226-99409248 CTCCAGCCCAGCCCTGGCTCTGG - Intergenic
1132206249 15:99988024-99988046 CCTTCCCCCAGCTCAGCCTCAGG + Intronic
1132701893 16:1225539-1225561 CCCTCCCTCAGCCCTGGCCCCGG - Intergenic
1132995538 16:2820594-2820616 CCCTCCCCCAGGTCTGGCTTTGG + Intronic
1133050781 16:3116085-3116107 TTCTCCTCCAGCTTTGGCCCAGG - Intronic
1133316250 16:4885809-4885831 CTCTCCTCCAGCACGGGATCCGG + Exonic
1133449506 16:5891752-5891774 CTCTACCCCAGCTCTGCCCCAGG - Intergenic
1134121013 16:11585444-11585466 TTCTCCACCAGCCCTTGCTCTGG - Intronic
1136428486 16:30184187-30184209 CTGTCCCCCACCTCTGGTCCGGG + Intronic
1136573902 16:31112110-31112132 CCCACCCCCAGCTTTGGCTTCGG + Exonic
1136848484 16:33595183-33595205 CTCACCCACAGCACTGGGTCTGG - Intergenic
1137983949 16:53092112-53092134 TTCCCCCCCAGCTGTGGATCAGG + Intronic
1138505789 16:57477695-57477717 CTCTGCCACAGCTCTGCCGCGGG + Intronic
1139371844 16:66473848-66473870 CTCTCCCACCCCTCTGGCTGCGG + Intronic
1139434111 16:66926323-66926345 ATCTGCCCCAGCCCTGGCCCTGG + Intergenic
1139547816 16:67657920-67657942 CTCCCTCCCAGCTCTACCTCAGG + Intronic
1140410601 16:74738413-74738435 GTCTCCCCGAGCTGTGGTTCAGG - Intronic
1141518066 16:84559580-84559602 CTCTGCCCCAGGGCTGGCCCTGG - Intergenic
1141930631 16:87200167-87200189 CTCTGTCTCAGCTCTGGCTGTGG - Intronic
1142202915 16:88769712-88769734 CTCAGCCCCAGACCTGGCTCAGG - Intronic
1142205300 16:88780026-88780048 CTCACCCCCTTCTCTGGGTCTGG - Intronic
1142261708 16:89045534-89045556 CTCTTCCTCACCTCTGTCTCAGG + Intergenic
1142441994 16:90104657-90104679 TTCTCCGCCAGCCCTGGCTGCGG + Intergenic
1203110191 16_KI270728v1_random:1443832-1443854 CTCACCCACAGCACTGGGTCTGG - Intergenic
1142966356 17:3584188-3584210 CTCACCGCAACCTCTGGCTCCGG - Intronic
1143112379 17:4559778-4559800 CTCTGTCCCAGCCGTGGCTCAGG - Intronic
1143296182 17:5873789-5873811 CTCTGCACCAGCTCAGCCTCAGG + Intronic
1143315039 17:6026186-6026208 CTCGCCTCCATTTCTGGCTCTGG - Intronic
1143338014 17:6188011-6188033 TTCTCTCCCAGCTCGGCCTCGGG + Intergenic
1143405815 17:6676644-6676666 CTCTCACAGAGCCCTGGCTCTGG - Intergenic
1143500729 17:7337047-7337069 CCCTCCCCCAGCACCTGCTCTGG + Intronic
1143527193 17:7479527-7479549 CCCGCCTCCAGCTCCGGCTCCGG + Intronic
1143632403 17:8146702-8146724 CCCGCCTCCAGCTCTGGGTCTGG + Exonic
1143890313 17:10097711-10097733 CTCTGCCCTCGCTCTGGGTCAGG + Intronic
1143940311 17:10534098-10534120 ATCTCTCCCAGGTCTGGGTCAGG - Intronic
1144765436 17:17730045-17730067 CTCTCTCCCAGTTCTGCCTTGGG - Intronic
1146058019 17:29590624-29590646 CTGGCCCCCAGGTCTGGCCCTGG - Intronic
1146183143 17:30709708-30709730 CTTCCCCCCAGCCCCGGCTCCGG + Intergenic
1147133410 17:38421753-38421775 CTCCCACCCAGGGCTGGCTCAGG + Intergenic
1147977456 17:44255873-44255895 TTCTCTCCCAGCTTTGGCTTGGG + Intronic
1148183198 17:45620964-45620986 CTCTCCGCTCCCTCTGGCTCTGG + Intergenic
1148221849 17:45868530-45868552 GTCTCCCCCACAGCTGGCTCTGG + Intergenic
1148265652 17:46224727-46224749 CTCTCCGCTCCCTCTGGCTCTGG - Intronic
1148781178 17:50122943-50122965 CCCTCCCCCAGCTCAGCCCCAGG - Intronic
1148830507 17:50427684-50427706 CTCTCAGCCTACTCTGGCTCAGG + Intronic
1148945499 17:51259531-51259553 CCCGCCCCCTGCTCTGGCTAGGG - Intronic
1149683443 17:58521185-58521207 CTCTCCCCTACCTATGCCTCTGG - Intronic
1150576214 17:66433269-66433291 CCCGGCCCCAGCTCTGGCCCCGG + Intronic
1151460715 17:74252584-74252606 CTGGGCCCCAGCTCTTGCTCTGG - Intronic
1151518543 17:74612840-74612862 CTCTCCCCATGCTCTGACTCTGG + Intronic
1152020960 17:77780021-77780043 CTCTCCCCCAGCCCCGGGACAGG + Intergenic
1152278794 17:79373170-79373192 GACTCCCCCAGCTGTGGCCCAGG + Intronic
1152405372 17:80095252-80095274 CTGTCTCCCAGGTCAGGCTCGGG + Exonic
1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG + Intronic
1152597663 17:81245848-81245870 TTGAGCCCCAGCTCTGGCTCTGG + Exonic
1152610138 17:81311406-81311428 CTCTCCCCCAGCTCCTGATGTGG + Exonic
1152649049 17:81483538-81483560 CTCTCCTCCAGCTGCCGCTCAGG + Intergenic
1152809847 17:82376208-82376230 CTCTCATCCACGTCTGGCTCAGG + Intergenic
1153353996 18:4115557-4115579 CTCACCGCAAGCTCTGCCTCCGG + Intronic
1153984397 18:10340054-10340076 CTCTCCCCCTTCCCTTGCTCAGG + Intergenic
1154196518 18:12271351-12271373 CTCTCCTCCTCCTCTGCCTCTGG - Intronic
1154494636 18:14946409-14946431 CTCTCTCCCATCCCTGGCCCTGG - Intergenic
1155246936 18:23919736-23919758 CTCTCTCTCAGCACTGCCTCTGG - Intronic
1155324396 18:24651488-24651510 CTCTCCCTCAGCTCTGGCAGTGG - Intergenic
1155904234 18:31429813-31429835 CTCTCCCTCTGCTCTGCCTTGGG - Intergenic
1156479371 18:37426485-37426507 CTCTCCCACAGCTCAGCCCCTGG - Intronic
1156659410 18:39328990-39329012 CTCTTAGCCAACTCTGGCTCAGG - Intergenic
1157593672 18:48851110-48851132 CCCGCCCCCAGCTCTGCCTTAGG + Intronic
1157794265 18:50560085-50560107 CGCTGCTCCAGCTCGGGCTCCGG - Exonic
1158137693 18:54224504-54224526 CTCTCCCCCTCCTCCTGCTCCGG + Exonic
1159550915 18:69894736-69894758 GGCTCTCCCAGCTCTGCCTCTGG - Intronic
1160241161 18:77124176-77124198 CTCCCCCTCATCTCTGCCTCTGG + Intronic
1161670777 19:5607722-5607744 CTCTGCCCTATCTCTGACTCAGG + Intronic
1161723720 19:5916913-5916935 CTGTCCCCCACCTGTGGTTCTGG - Exonic
1161930133 19:7333906-7333928 ACCTCTCCCAGGTCTGGCTCAGG + Intergenic
1162060045 19:8089510-8089532 CCCTTCCCCAGCTCTGTCCCAGG - Intronic
1162118409 19:8445715-8445737 CTCGCCCCACGCTCTGGCCCTGG + Intronic
1162975651 19:14206066-14206088 CTTCCCCCCAGCCCCGGCTCCGG - Exonic
1163004383 19:14388531-14388553 CCCTCCCCAGGCTCTGGCTGTGG - Intronic
1163063080 19:14774203-14774225 CCCTCCCCAGGCTCTGGCTGTGG + Intronic
1163663675 19:18593312-18593334 CTCACCCCCAGCCCTGGCAGGGG + Exonic
1163796833 19:19342699-19342721 CCCGCCCCCAGCCCTGGCCCGGG - Intronic
1164737853 19:30554961-30554983 CTCTCTCACATCTCTGGCTTTGG - Intronic
1164761935 19:30734779-30734801 CTCTCCCCCGGGTCTGGCCCAGG - Intergenic
1165230081 19:34381330-34381352 CCCTGCCCCATCCCTGGCTCTGG + Intronic
1165566593 19:36734550-36734572 CTCACCCCAACCTCTGCCTCTGG - Intronic
1165726373 19:38115669-38115691 CTCTCCCCCAGCTCTTCCTCTGG + Intronic
1165745846 19:38229240-38229262 CTCTCCTCCATCTCTCCCTCAGG - Intronic
1166161792 19:40959484-40959506 CTCTCCCCCTTCTCTCTCTCTGG + Intergenic
1166852504 19:45767371-45767393 CTCTCCCCCACCTCGGCCTCGGG + Intronic
1166871508 19:45873660-45873682 CTTTCCCCCAACTCTGGTCCAGG + Exonic
1166977386 19:46612670-46612692 CTCCCCACTGGCTCTGGCTCTGG - Intergenic
1167674343 19:50875177-50875199 GTCTCCCCCGTCTCTGTCTCTGG + Intronic
1167751888 19:51385817-51385839 CTCTCTCTCAGGGCTGGCTCCGG + Intronic
1168212587 19:54901285-54901307 CTCTCTGCAAGCTCTGCCTCCGG - Intergenic
1168468108 19:56620230-56620252 CTCTCCCCTGGCTGGGGCTCCGG - Intronic
925066078 2:929601-929623 CTGTTCCCCAGCTCTGGCAAGGG + Intergenic
925309688 2:2873798-2873820 CTCTCTCCCAGTTATGCCTCTGG - Intergenic
926455466 2:13062132-13062154 CTCTCCGCCAGCTCTGTGTAAGG - Intergenic
927097031 2:19755151-19755173 CTCTCCGTCAGCTCTGGAACGGG - Intergenic
927153170 2:20207144-20207166 CTCTGCCCCAGGGCTGCCTCAGG - Intronic
927682222 2:25147156-25147178 CTCTCTCCCTGCTCTTGCCCAGG + Intronic
927920826 2:26970853-26970875 CCCTCCCCCAGCCCGGGCCCTGG - Intronic
928166694 2:28977308-28977330 GCCTCCCCCATCTCTGTCTCAGG - Intronic
931879498 2:66553540-66553562 CGCCCCGCCAGCTCTGTCTCAGG - Intronic
932398015 2:71461464-71461486 CGCTCTCCTAGCTCTAGCTCCGG - Intronic
933206752 2:79515039-79515061 CACTTCCCCAGCACTGACTCAGG - Intronic
933970317 2:87464711-87464733 CTCTCCTCCAACTCTGGCATTGG + Intergenic
934053227 2:88227723-88227745 CTCTCCCCCAACTTGGTCTCAGG + Intergenic
934971265 2:98766367-98766389 CTCCCCATCAGCTCTGGTTCTGG + Intergenic
935039768 2:99415057-99415079 CCCTCCCCCACCTCCGGTTCAGG - Intronic
935310154 2:101775590-101775612 CTCACCCCCAGCACTAGCCCAGG - Intronic
936050171 2:109216565-109216587 CTCTGCCCCACCTCAGGCTTCGG - Intronic
936323467 2:111485785-111485807 CTCTCCTCCAACTCTGGCATTGG - Intergenic
937836177 2:126472173-126472195 CCCTCCCCAGGCTCTGACTCAGG + Intergenic
937839464 2:126511124-126511146 CTCTCGCCCTGCTCTGGTGCAGG + Intergenic
938075146 2:128327893-128327915 CTCTGCCCCAGCCCAGGCCCAGG - Intergenic
938096688 2:128468506-128468528 CTTTTCCCCTGCTCTGTCTCTGG + Intergenic
939486908 2:142826033-142826055 CTCTCCCACAGCTCTATGTCTGG - Intergenic
939552554 2:143633911-143633933 CTTACCCCCAACTCTGACTCAGG + Intronic
942457624 2:176148855-176148877 CTCCTCCCCTGCACTGGCTCTGG + Intergenic
942471191 2:176262446-176262468 CTCACCGCAAGCTCTGCCTCCGG + Intergenic
943669076 2:190641481-190641503 CACTCTCCCAGCTCAGTCTCTGG - Intergenic
944763398 2:202840446-202840468 CTCGGCTCCAGCTTTGGCTCTGG - Intronic
944819930 2:203419912-203419934 CTCTCCCCAACCTCCGCCTCTGG - Intronic
945416045 2:209574213-209574235 CTGTCCCCCAGCCCTGTCACTGG + Intronic
946307668 2:218865363-218865385 CTCTCCCTCAGCTCCTCCTCCGG - Intronic
946469046 2:219939605-219939627 GGCTGCCCCAGCTGTGGCTCAGG + Intergenic
947740531 2:232482821-232482843 CTGACCCCCAGCTCTGGGCCAGG + Intronic
947792750 2:232877185-232877207 CTCACCCCCAGGCCTGGCTGGGG + Intronic
948024365 2:234765101-234765123 TTCTCCCCCAGCCCTGGGTGGGG - Intergenic
948208518 2:236175871-236175893 CTGTCTCCCAGCTCTCCCTCTGG + Intergenic
948599644 2:239100969-239100991 CTTTCCACCAGCTTTGGCCCAGG + Intronic
948616685 2:239203725-239203747 CTCACCCCCAGCCCTGGCTGGGG + Intronic
948689946 2:239695569-239695591 CTCTCCCTGCCCTCTGGCTCCGG - Intergenic
948739056 2:240030971-240030993 CTCTCCCCCACCTGTGGACCAGG - Intergenic
948785957 2:240353111-240353133 CTGGCCTCCAGCTCTGGGTCTGG + Intergenic
1168835338 20:873902-873924 CTCCACACCAGCTGTGGCTCAGG - Intronic
1169124024 20:3114282-3114304 TTCTCTACCAGCTCTGGCCCTGG - Intronic
1172444130 20:34984434-34984456 CTCTGCCCCAGCCCGGCCTCTGG - Intronic
1172630801 20:36376960-36376982 CTCTCACCCACCTCTGCCCCTGG - Intronic
1173201077 20:40955477-40955499 TCCTCCCCCTGCTCTGGCCCTGG - Intergenic
1173964376 20:47100735-47100757 CCCTCCTCCAGCTCTCGCTAAGG + Intronic
1174338584 20:49882304-49882326 CTCCCCTCCAGGTCTGGCTGCGG - Intronic
1174364764 20:50049921-50049943 CCCTCCCCCAGGTCTGGGCCTGG + Intergenic
1174487766 20:50871894-50871916 CTCCCCCACAGCTCAGGCTGGGG - Intronic
1174747968 20:53083026-53083048 GACTCCCCCAGCTCTGTCTTTGG + Intronic
1174997022 20:55581434-55581456 CCCTACCCCAGCTCAGGCCCCGG - Intergenic
1175107488 20:56625654-56625676 CTCTCCCCCTGCCCTGCCCCGGG - Intergenic
1175875850 20:62228928-62228950 GTCGCCCCCTGCCCTGGCTCAGG - Intergenic
1175937108 20:62518919-62518941 CACTCGCCCAGCTCAGCCTCGGG - Intergenic
1175942420 20:62543594-62543616 CTCTCTCCCAACTGTGGCTGGGG + Intergenic
1175960492 20:62634162-62634184 CTCCCCTGCAGCTCTGGCGCAGG + Intergenic
1176016674 20:62937614-62937636 CTCTCGCCCAGCCCGGTCTCGGG + Intronic
1176866954 21:14059087-14059109 CGCTGACCCAGCTTTGGCTCTGG - Intergenic
1177773169 21:25539520-25539542 CTGTCACCCTGCTCTGGCCCAGG - Intergenic
1177781900 21:25630840-25630862 CTTTCCCCCAGCTCCCGCTAAGG + Intergenic
1178287018 21:31334390-31334412 TTCTCCCCCTGCTCAGCCTCCGG + Intronic
1178396332 21:32246798-32246820 GTCTGCCCCAGCTCCCGCTCTGG - Intergenic
1178685145 21:34704837-34704859 CTCTCCGCCTGCTCGGTCTCTGG - Intronic
1178785375 21:35648582-35648604 CTGAGCCCCAGCTCTGCCTCAGG - Intronic
1178971070 21:37177340-37177362 ATCTTCCCCAGCCCGGGCTCTGG - Intronic
1179125118 21:38583594-38583616 CTCTCCCCCAGTTCATGCACTGG + Intronic
1180150415 21:45944324-45944346 CTCACGCCCAGCTGGGGCTCTGG - Intergenic
1181309648 22:21937677-21937699 GTCTCCCCCAGCCCGAGCTCAGG - Intronic
1181846407 22:25712810-25712832 CTCTTTCTCAGCTCTTGCTCAGG - Intronic
1182049985 22:27305280-27305302 CTTCCCCCCAGCCCTGACTCCGG + Intergenic
1182619625 22:31611755-31611777 CTCTCCCCCAGCTCCTGCACAGG + Exonic
1182900809 22:33896849-33896871 CTCTCCCCCAGCTGTGCTACAGG + Intronic
1183430857 22:37764914-37764936 GTCTCTCCTAGCTCTGTCTCTGG - Intronic
1183666610 22:39249851-39249873 CCCTCTCCTAGCGCTGGCTCTGG - Intergenic
1183697376 22:39430911-39430933 CTCTCCCGCACGCCTGGCTCTGG - Exonic
1183902965 22:41020274-41020296 CTGTCCCCCAGCTCTGGGGAGGG - Intergenic
1184015742 22:41784539-41784561 CTCCCACCCAGCTCTGTCACAGG - Intronic
1184090399 22:42290171-42290193 CTCTGGCCCACCTCTGGCCCTGG - Intronic
1184419541 22:44371677-44371699 ACAGCCCCCAGCTCTGGCTCTGG + Intergenic
1184457371 22:44618772-44618794 GTCTCCCCCAGCTCCCGCCCAGG - Intergenic
1184541239 22:45126734-45126756 CTCTCTCCCATCTCTTGCTAAGG + Intergenic
1184714680 22:46274102-46274124 CACTCCCCCAGCTCAGCCTCAGG - Intronic
1184851651 22:47124667-47124689 CACTCCCCAAGCCCTGCCTCTGG - Intronic
1184949693 22:47832528-47832550 CTCTCCACCAGATCTGGGGCAGG + Intergenic
1185275524 22:49948880-49948902 CTGTCCCCCAGCCCTGGCCAGGG + Intergenic
1185324801 22:50220349-50220371 TCCTCCCCCAGCTCGGGCTGCGG - Exonic
950014876 3:9748511-9748533 CTCCATCCCAGCTCTGTCTCCGG - Intergenic
950124479 3:10503084-10503106 CGTTCCCCCAGCTCAGGCGCAGG - Intronic
950337519 3:12209425-12209447 CTCTCCCCCACCTCTACCTGTGG + Intergenic
950498556 3:13349269-13349291 CTCACCCCCAGCTCTCGGTCAGG + Intronic
950518226 3:13480752-13480774 CCCGCCCCCCGCCCTGGCTCAGG + Intronic
952197021 3:31086338-31086360 CTCATCCCCAGCTCTGGGACTGG + Intergenic
952339386 3:32432569-32432591 CTGGGTCCCAGCTCTGGCTCCGG + Intronic
953167745 3:40480570-40480592 CTCACTCCAAGCTCTGCCTCCGG + Intronic
954371093 3:50169927-50169949 CCCACCCCCTGCTCTGACTCAGG + Intronic
954839213 3:53495861-53495883 CCCCTCCCCAGCTCTGGCCCGGG + Intronic
954876301 3:53805197-53805219 CTCTCCCCCAACCCCCGCTCTGG + Intronic
954904351 3:54047148-54047170 CTCTCCACCAGCACTGACTCAGG - Intergenic
955121401 3:56062919-56062941 CCCTGCCCCAACTCTGGCTTCGG + Intronic
955201601 3:56856574-56856596 CTCTCCCTGACCTCTGTCTCTGG + Intronic
956193164 3:66626193-66626215 CTCAGCCCCAACTCTGGGTCAGG - Intergenic
956733608 3:72218656-72218678 AGCTCCCCCATCCCTGGCTCCGG - Intergenic
959106486 3:102070491-102070513 CTCATCCCCAGCTCTGTATCAGG - Intergenic
959350040 3:105250389-105250411 CCCTCCCTCAGCTGTAGCTCTGG - Intergenic
959951502 3:112184978-112185000 TTCTCCCCCAGCCCAGGCTGGGG + Intronic
961390673 3:126550714-126550736 CACTCCCCCAGCCCTGGCATGGG + Intronic
961400602 3:126639453-126639475 CTCTCGCCCAGCTCTCTTTCAGG + Intronic
962010984 3:131390570-131390592 TTCTCCCCCAGATCTTGATCTGG - Intergenic
962240691 3:133748401-133748423 CTCTCCCCCAGGGCTGTGTCTGG + Exonic
962844051 3:139260106-139260128 TGCTCCCCAGGCTCTGGCTCTGG - Intronic
962935257 3:140074743-140074765 ATCTCCCCAAGCTCAGGCTCCGG - Intronic
963209302 3:142671495-142671517 CTCTCCCCCATTCCTAGCTCAGG - Intronic
963380893 3:144528892-144528914 CTCTCCCCCTGCTCTTGCCCAGG + Intergenic
963791877 3:149591271-149591293 CACATCCCCAGCTCTGGCTTAGG - Intronic
966268190 3:178071921-178071943 CACTCCCCCGGCTCTGTCCCAGG + Intergenic
966350373 3:179027713-179027735 CAGTTCCCCAGCTGTGGCTCAGG - Exonic
966480205 3:180399802-180399824 ATCTCCCCCAGCTGGGCCTCAGG + Intergenic
968036193 3:195550048-195550070 GTCTCTCCCAGCTCTGGCTCTGG + Intergenic
968323501 3:197791706-197791728 CTCTCCCCAGGCTCTGGGTCTGG - Intronic
968362264 3:198155623-198155645 TTCTCCGCCGGCTCTGGCTGCGG + Intergenic
968744614 4:2353202-2353224 CTGCACCCCAGCCCTGGCTCTGG - Intronic
968816329 4:2823655-2823677 CTGGCACCCAGCTCTGGTTCTGG + Intronic
968907746 4:3462514-3462536 CTGTCCCCAAGCTCTGGCCTGGG - Intergenic
968938081 4:3624067-3624089 TCCCCTCCCAGCTCTGGCTCAGG + Intergenic
968968894 4:3783393-3783415 CTCCCTCCCAGCCCTGGCACAGG - Intergenic
969155403 4:5205556-5205578 GTCTCCCCAGGCTCTGGCTGTGG + Intronic
969308359 4:6338395-6338417 CCCACCCCCATCCCTGGCTCAGG + Intronic
969365543 4:6692246-6692268 CTCTCCCACTTCTCTGGCTGGGG + Intergenic
969456156 4:7300828-7300850 CTCTTCCACAGGACTGGCTCAGG - Intronic
969480661 4:7445322-7445344 CTCTCCCCCGGCTTTCCCTCTGG - Intronic
969581545 4:8068389-8068411 CTCTGACCCAGCACTGGCTGAGG - Intronic
969590857 4:8121260-8121282 GTCTCTCCCAGCTCTGCCCCTGG - Intronic
969633793 4:8353564-8353586 CCCTGCCCCAGCACTGGCACTGG - Intergenic
970250982 4:14115801-14115823 TTCTCTCCCAGCTCTGCCACTGG - Intergenic
970765162 4:19539417-19539439 CTCTAGGCCAGCTCTGGCACAGG - Intergenic
971198053 4:24488058-24488080 CTCCTCCCCAGCTCTGGCACAGG + Intergenic
972370129 4:38415669-38415691 CTCTCTCCCATCTCAGTCTCAGG - Intergenic
973070882 4:45856656-45856678 CTCCCCCCGAGTTCTGGCCCAGG + Intergenic
975995373 4:80307970-80307992 CTCTCCCTCAGCTCTTGCGTGGG - Intronic
977180882 4:93872331-93872353 CTGTCTCCCATCTCTGGCCCTGG - Intergenic
978935332 4:114367795-114367817 CTCTCTCAAAGCTGTGGCTCAGG - Intergenic
979674750 4:123398610-123398632 CTCTCCCGGAGTCCTGGCTCGGG - Intronic
980877033 4:138671985-138672007 CTCTGCCACTGCTCTGGCTTGGG - Intergenic
983561890 4:169109901-169109923 CTCCCTCCCACCTCAGGCTCCGG - Intronic
985238076 4:187898622-187898644 CTCTCCCCCAGCCCTGGCAATGG + Intergenic
987869639 5:23598560-23598582 CTGTCCCCCATCTCAGCCTCAGG - Intergenic
988977455 5:36529097-36529119 CTTCCTCCCAGCTCTGCCTCAGG + Intergenic
989096580 5:37787453-37787475 GTCTCCCCAAGCTCTGGGCCAGG - Intergenic
989601754 5:43206675-43206697 CACTCCCCCAGGTATGGCACAGG + Intronic
989843663 5:46112171-46112193 GTCTCGCCCTGCTTTGGCTCAGG + Intergenic
990481921 5:56220032-56220054 CTCTCCCTCAGCTCAGCCTCCGG - Intronic
991298182 5:65103067-65103089 CTCTCCTCCCGCTCGGGCCCGGG - Intergenic
991977528 5:72197810-72197832 TTCTCAACCAGCACTGGCTCTGG + Exonic
993040049 5:82804158-82804180 CTGTCCCCCAGCTCCAGCTGTGG - Intergenic
993169647 5:84401859-84401881 CTCTGCCCCTGTTTTGGCTCTGG + Intergenic
995947033 5:117660378-117660400 TTCTCTTCCTGCTCTGGCTCTGG - Intergenic
996887469 5:128374652-128374674 CTGTCCCCCAGGCCTGGCTGTGG - Exonic
998183377 5:139961119-139961141 CTGCCGCCCAGCTCTGACTCAGG + Intronic
998381538 5:141729518-141729540 CTGTGCCCCAGGCCTGGCTCTGG + Intergenic
999282846 5:150376219-150376241 CTCATCCCCAGCTGTGGCTGGGG + Exonic
999367166 5:151030599-151030621 CTCTCATCCAGCTGAGGCTCTGG + Exonic
999685436 5:154098473-154098495 CTTTCCCCCAGCTCCAGCTATGG - Intronic
1000921286 5:167140936-167140958 CTATACCCCAGCACTGCCTCAGG - Intergenic
1001082855 5:168679775-168679797 CTCTCCCACCGTGCTGGCTCCGG - Intronic
1001494184 5:172176410-172176432 CACTCCCTCAGCTCTGATTCGGG + Intronic
1001709814 5:173769344-173769366 CTCTCCCTCAGCCCTGACGCTGG + Intergenic
1001896244 5:175383974-175383996 CTCTGACACTGCTCTGGCTCTGG - Intergenic
1002324795 5:178397245-178397267 CTCCCCCTCAGCTCTGCCCCCGG - Intronic
1002348001 5:178561379-178561401 CTCTCACCCAAATCTGGCACAGG - Intronic
1002562200 5:180090215-180090237 CTCTCCCTCAGCTCAGCCGCGGG + Intergenic
1002603926 5:180370879-180370901 CCCTCCCTGAGCTGTGGCTCTGG - Intergenic
1004015527 6:11728576-11728598 CTCTCCCCCAACCCTGATTCGGG + Intronic
1004512989 6:16297655-16297677 TCCTCCCCCAGCTCTGGCACAGG - Intergenic
1004902069 6:20204208-20204230 TTCTCCCCTAGCACTGTCTCAGG + Intronic
1005209393 6:23443211-23443233 CTCAACCCCAGCTCTGAATCTGG + Intergenic
1005297661 6:24442516-24442538 CTCACTGCAAGCTCTGGCTCCGG + Intronic
1005517538 6:26569235-26569257 CTTTCCCCCGGCTGTGGATCCGG - Intergenic
1006057397 6:31395696-31395718 CTCTCCCTCAGCGCTGGCTCTGG - Intergenic
1006069819 6:31490352-31490374 CTCTCCCTCAGTGCTGGCTCTGG - Intergenic
1006185644 6:32180218-32180240 CTCTCCCACAGGTGTGGATCTGG + Exonic
1006219898 6:32479930-32479952 CTCACTGCCAGCTCTGCCTCTGG - Intergenic
1006453893 6:34121335-34121357 CTCCTTCCCAGCTCAGGCTCTGG - Intronic
1007168950 6:39848761-39848783 CTCTCCCCCAGCCCTGCCTGAGG + Intronic
1007370858 6:41426545-41426567 ACCTCCTCCAGCTCTGGCGCTGG - Intergenic
1007414356 6:41683358-41683380 CCCCCGCCCCGCTCTGGCTCTGG - Intergenic
1007582837 6:42969444-42969466 CTGTCCTCCAGGGCTGGCTCTGG - Intronic
1010089286 6:71961042-71961064 TTCTTCCCCACCTCTGGCACAGG + Intronic
1011516935 6:88165846-88165868 CTCTCGCCCAGCTCAGGGGCTGG + Exonic
1014787509 6:125635204-125635226 CTCTCCCACAGCTCTCCCTATGG - Intergenic
1015213447 6:130722629-130722651 TCATCCCCCAGTTCTGGCTCTGG - Intergenic
1015517844 6:134102194-134102216 CTCTCACACAGCTCTGGAGCTGG - Intergenic
1016822915 6:148362959-148362981 CTCTCTCCCAGCTCTGTCCTGGG - Intronic
1017007353 6:150037782-150037804 CTGTCCCCGAGCTCTGGACCCGG + Intergenic
1017965464 6:159260828-159260850 CTCTAGCCCTGCTCTTGCTCAGG - Intronic
1018078672 6:160239691-160239713 TTCTCCCCCAACACTGGCTAAGG - Intronic
1018429643 6:163713209-163713231 CCTGACCCCAGCTCTGGCTCAGG + Intergenic
1018723068 6:166588563-166588585 CTGTCCCCAACCTCTCGCTCTGG + Intronic
1019111550 6:169720916-169720938 CTTTCCCCCAGCTCTGGCAAAGG - Intronic
1019433445 7:1010252-1010274 CTGTCCCCAAGCACTGGGTCTGG + Intronic
1019497200 7:1346210-1346232 TTCACCCCAAGCTCTGGCCCTGG + Intergenic
1019524368 7:1474109-1474131 CACTCCCTCTGCTCTGGCCCAGG - Intronic
1019548752 7:1591950-1591972 CTCCCAGACAGCTCTGGCTCAGG - Intergenic
1019709223 7:2510760-2510782 CTCCCACCCAGCTCCAGCTCAGG + Intergenic
1020087198 7:5316886-5316908 GTCTCCCTCAGCCCTGCCTCTGG - Intronic
1020143400 7:5624624-5624646 CTCTCCCCGAGGCCTGGCCCAGG - Intronic
1021882307 7:25106736-25106758 CTCTACCCCAGCCCTGTCCCTGG - Intergenic
1022468454 7:30666763-30666785 CCCTGCTCCAGCTCTCGCTCTGG - Intronic
1022691179 7:32656778-32656800 CTGTCCCCCAGGTCTGGGTAGGG + Intergenic
1023624474 7:42102345-42102367 CCTTCCCCCAACTCAGGCTCAGG - Intronic
1023870129 7:44258818-44258840 CTCACTCCCAGCCTTGGCTCAGG - Intronic
1024063522 7:45715673-45715695 GCCTCCCCCAGCTATGGCCCAGG - Exonic
1025152837 7:56573862-56573884 CTCTCCCACAGTTCAGACTCTGG - Intergenic
1025207105 7:57000272-57000294 GTCTCCCTCAGCCCTGCCTCTGG + Intergenic
1026853173 7:73737375-73737397 CGTTCCACCAGCTCTGGCTGTGG + Exonic
1027265842 7:76494858-76494880 CTGCTCTCCAGCTCTGGCTCCGG - Intronic
1027317214 7:76992975-76992997 CTGCTCTCCAGCTCTGGCTCCGG - Intergenic
1028567171 7:92246100-92246122 CCCTCCCCCGCCTCCGGCTCCGG - Exonic
1029104031 7:98159748-98159770 CTAGACCCAAGCTCTGGCTCTGG - Intronic
1029112104 7:98217757-98217779 CTGTCCCCCGGCTCAGGCTGTGG + Exonic
1029162776 7:98564313-98564335 CTGTTCCCCAGCTCTGAATCTGG - Intergenic
1029551916 7:101241061-101241083 CTGTCCCAGAGCTCTGGCTAGGG - Intronic
1029646420 7:101859227-101859249 CTCTCCCCCAGCTCAGGTGCAGG - Intronic
1031929224 7:127667534-127667556 CTGTCCCCCATCCCTGGATCAGG + Intronic
1031975338 7:128090079-128090101 CTCCTCGACAGCTCTGGCTCGGG - Intronic
1032787322 7:135211299-135211321 CTTCCCCCCAGCACTGCCTCCGG - Intronic
1033223753 7:139545014-139545036 CCCTCCCCGAGCTCTGACTCTGG - Intergenic
1035264844 7:157685017-157685039 CTCCCGCCCAGGTATGGCTCCGG - Intronic
1035397876 7:158546906-158546928 CTGTCCCCCAGCCCTGCCCCAGG - Intronic
1035587923 8:790079-790101 TTCTCCACTGGCTCTGGCTCTGG - Intergenic
1036692088 8:10950388-10950410 CTCTCCCCCAGCCCTGGCACAGG - Intronic
1038189726 8:25308933-25308955 GTCCCTCCCAGCTCTGGCACTGG - Intronic
1040000791 8:42575026-42575048 TTCTCACCCAGGTCTGTCTCTGG - Intergenic
1040038900 8:42896982-42897004 CTCTCGCCCAGCGCTGGCAGCGG - Exonic
1040803220 8:51366435-51366457 CTCTGAGCCTGCTCTGGCTCAGG + Intronic
1041143605 8:54847773-54847795 CTGTTTCCCAGCTCAGGCTCTGG + Intergenic
1042226106 8:66515625-66515647 CTGTCCCCCTGCTCTGGGTCTGG - Intronic
1042765373 8:72315501-72315523 CTCTCTCTCACCTCTTGCTCTGG + Intergenic
1043878108 8:85509365-85509387 CTCTGACCCTACTCTGGCTCAGG - Intergenic
1045362912 8:101449531-101449553 CTTTCACCCAGCTCTCTCTCAGG + Intergenic
1045404525 8:101852427-101852449 CTGCAACCCAGCTCTGGCTCTGG + Intronic
1046732256 8:117738319-117738341 TCCTTCCTCAGCTCTGGCTCCGG - Intergenic
1047482051 8:125293069-125293091 CTGTGCCCCAGCTCTGTTTCAGG + Intronic
1047717148 8:127606005-127606027 TTCTCTCCCAGGACTGGCTCTGG - Intergenic
1048030987 8:130631931-130631953 CTCTACCCCAGCTCTGGGAGTGG + Intergenic
1048680715 8:136838627-136838649 CTCTCAGCCTACTCTGGCTCAGG - Intergenic
1049209058 8:141376999-141377021 GGCTCCCCCAGGTCTGGCTGGGG - Intergenic
1049353272 8:142175520-142175542 CCCTGCACCTGCTCTGGCTCTGG + Intergenic
1049538498 8:143194336-143194358 CTCTCCCCCAGCCCCTGCACTGG - Intergenic
1049538511 8:143194383-143194405 CTCTCCCCCAGCCCCTGCACTGG - Intergenic
1049538525 8:143194430-143194452 CTCTCCCCCAGCCCCTGCACTGG - Intergenic
1049538581 8:143194631-143194653 CTCTCCCCCAGCCCCTGCACTGG - Intergenic
1049641804 8:143719287-143719309 CCCACCCCCACCTCTGCCTCTGG + Intronic
1049804991 8:144534642-144534664 GCCTCCCCCAGCACTGGCTGCGG - Intronic
1049838419 8:144754974-144754996 ATCCCCCCGGGCTCTGGCTCTGG - Intronic
1049845191 8:144797364-144797386 CTCCCAACCAGCTGTGGCTCTGG + Intergenic
1050165603 9:2761738-2761760 CTCTGAGCCTGCTCTGGCTCAGG + Intronic
1053062705 9:35044318-35044340 CCCACCCCCAGCTCTTGCACCGG + Exonic
1054453091 9:65413639-65413661 TCCCCTCCCAGCTCTGGCTCAGG - Intergenic
1055013447 9:71591689-71591711 CTCTCATCCAGCTCTGCCTTAGG + Intergenic
1055452316 9:76442057-76442079 CTCTTCACCAGCTCTGGCTCAGG + Exonic
1055791615 9:79928731-79928753 CTCTTCTCCAACTCTGGCTCTGG - Intergenic
1057206682 9:93177778-93177800 CAGACCCCCATCTCTGGCTCTGG + Intergenic
1057961841 9:99464740-99464762 CTCTCCCCCATCCTTTGCTCTGG - Intergenic
1058663027 9:107283449-107283471 CTCTCCCCCAGCCCGTGCCCCGG - Exonic
1058858053 9:109086009-109086031 CTATCCTCAAGCTCTGGCACTGG - Exonic
1059473429 9:114524718-114524740 CTCCCCCCCACCTCCAGCTCTGG - Intergenic
1059975803 9:119715741-119715763 CTCTCCACCTGCCCTGCCTCTGG - Intergenic
1060207430 9:121690435-121690457 CTCTCAGCCAGCCCTGGCTAAGG - Intronic
1060231313 9:121827448-121827470 CTCGACCCCAGCTCTGGGACTGG + Intronic
1060515203 9:124261242-124261264 CTCTCCAGTAGCTCTGGCCCTGG - Intronic
1061057655 9:128232920-128232942 CCCTGCCCCAGCCCTGCCTCGGG + Intronic
1061160786 9:128892676-128892698 CTCTCCTCCCACTCTGGCTCTGG + Intronic
1061182081 9:129030281-129030303 CCCTCTCCCAGCCCTGGTTCTGG + Intergenic
1061246218 9:129402395-129402417 CTCTTCCCCAGCTCGGGCCTTGG + Intergenic
1061603916 9:131694054-131694076 CCCTCTCCCACCTCTGCCTCAGG + Intronic
1061798259 9:133100933-133100955 CTGTACCCCAGCCCTGGGTCAGG - Intronic
1062024363 9:134333436-134333458 ATCACCCCCAGCCCTGGCCCCGG - Intronic
1062326791 9:136016396-136016418 CTCTCCAGCGGCACTGGCTCAGG + Exonic
1062342740 9:136100950-136100972 ATCTCCCGCAGAGCTGGCTCGGG + Intergenic
1062690441 9:137838760-137838782 GTCTCCCCCAGCTCTCACTGAGG + Intronic
1203768182 EBV:37235-37257 CCCTCCCCCTGCTCTGTCCCCGG - Intergenic
1188022035 X:25169819-25169841 GCCTGCCCCAGCTCTGGCTGGGG + Intergenic
1191257599 X:58286364-58286386 GACTCCCCCAGATCGGGCTCGGG + Intergenic
1191797465 X:65035593-65035615 CTTTCCCCTCGCTCTGGCTCTGG + Intergenic
1192233941 X:69284494-69284516 CTGTTCCCCAGCTCTTGTTCTGG - Intergenic
1192234166 X:69285571-69285593 CTTTCCCTCTGCCCTGGCTCGGG - Intergenic
1194755829 X:97738098-97738120 CTCTCTGCCTACTCTGGCTCAGG + Intergenic
1196808009 X:119605875-119605897 CACTGCTCCAGCACTGGCTCGGG + Exonic
1196966889 X:121065810-121065832 CTCTCCTCCAGCTCTGGGAAGGG - Intergenic
1197858624 X:130946446-130946468 CTCTCCTCCAGCTCTGTGTATGG + Intergenic
1198011499 X:132560590-132560612 CCCTCCTCCTGCTCTGCCTCAGG - Intergenic
1198051364 X:132956154-132956176 CTCCTTCCCCGCTCTGGCTCTGG - Intronic
1198802371 X:140460744-140460766 CTCTTCTCCATCTCTGCCTCTGG + Intergenic
1199500512 X:148501267-148501289 CTCTCAGCCACCTCTGGCCCCGG + Intronic
1199756941 X:150873754-150873776 CTCTTCCCCATCTCATGCTCTGG - Intronic
1199927321 X:152480887-152480909 CTGGGCTCCAGCTCTGGCTCTGG + Intergenic