ID: 1129750357

View in Genome Browser
Species Human (GRCh38)
Location 15:78058666-78058688
Sequence TTCACCAAAGACACGCCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 34}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129750355_1129750357 -7 Left 1129750355 15:78058650-78058672 CCAGGACCACACAGCATTCACCA 0: 1
1: 0
2: 5
3: 48
4: 397
Right 1129750357 15:78058666-78058688 TTCACCAAAGACACGCCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 34
1129750352_1129750357 16 Left 1129750352 15:78058627-78058649 CCAGTCAGCGCAGAAGCTAACGG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1129750357 15:78058666-78058688 TTCACCAAAGACACGCCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129750357 Original CRISPR TTCACCAAAGACACGCCCGC CGG Intronic
911552854 1:99305731-99305753 TTCAGCACAGAGACGCCCTCAGG + Exonic
1065325284 10:24545358-24545380 TTCACCAAAGAAAAGCCACCTGG - Intronic
1077008663 11:370444-370466 TTCACCGAAGGCGCCCCCGCCGG - Intronic
1078468900 11:11571292-11571314 TTCTCCAAAGACATGCCCTTGGG - Intronic
1081870545 11:46381006-46381028 TTCACCAAATCCAGGCCTGCGGG + Exonic
1091793912 12:3286665-3286687 TTCATCCAAGACACACCCCCAGG + Intergenic
1093980469 12:25469909-25469931 AGCACCAAAGACAGTCCCGCTGG + Intronic
1097041515 12:56158690-56158712 TTCACCGAAGACCAGACCGCAGG + Exonic
1097714827 12:62955013-62955035 TTCACCATAGCCACCCCCGTTGG + Intergenic
1104061283 12:125270648-125270670 TTCACCAAAGACACGGATGAGGG + Intronic
1106483095 13:30151271-30151293 GTCCCCAAAGACACACCCACAGG - Intergenic
1122234634 14:100324724-100324746 TTCTCCAAGGACACGGCCGAGGG - Intronic
1122330448 14:100908778-100908800 TTCTCCAAAGACAAGCACACAGG - Intergenic
1129750357 15:78058666-78058688 TTCACCAAAGACACGCCCGCCGG + Intronic
1140249021 16:73278323-73278345 TTTACCAAAAACATGCACGCTGG - Intergenic
1141178276 16:81734887-81734909 CCCACCACACACACGCCCGCTGG - Intergenic
1148646690 17:49223492-49223514 TTCACCAAAGTCACCCTCGCGGG - Exonic
1158957296 18:62552137-62552159 TTCCCTAAAGACACGGCCTCAGG + Intronic
931261363 2:60622375-60622397 TTGACCAAAGACACAGCCCCAGG - Intergenic
945037986 2:205720701-205720723 TTCAGCAAAGCCAAGCCAGCTGG - Intronic
1178706166 21:34874952-34874974 TCCACCAAACACAAGCCGGCTGG + Intronic
1183171208 22:36189564-36189586 TCCACTAAAGACCCGCCCCCCGG - Exonic
951670109 3:25171686-25171708 TTCAGCAAATCCACCCCCGCAGG - Intergenic
954585747 3:51734757-51734779 TTCACCCAAGACTGGCCCCCTGG + Intergenic
981871095 4:149487009-149487031 TTCACCATAGACACCACAGCTGG + Intergenic
1003224060 6:4189036-4189058 TTCACCGCAGCCACGGCCGCAGG + Intergenic
1003624312 6:7727887-7727909 GTCCGCAAATACACGCCCGCTGG - Intronic
1019258344 7:65782-65804 GTCAGCAAGGACACGCCGGCAGG - Intergenic
1019323915 7:428734-428756 ATCACCACAGACACTCCCACTGG + Intergenic
1034138852 7:148798049-148798071 TTGACCATAGACACGTCCCCCGG + Intronic
1036674513 8:10818885-10818907 TTCACCAAGGACATGGCCTCTGG - Intronic
1048468565 8:134687288-134687310 TTCAGCAAAGAAACACCCACGGG - Intronic
1060519381 9:124285629-124285651 ATCTCCAAACACAGGCCCGCTGG + Intronic
1062444204 9:136586892-136586914 CTCACCAGAGCCACGCCCTCCGG - Intergenic
1062516148 9:136937554-136937576 CTAACCAAAGACACCCACGCAGG - Intronic
1189714694 X:43853385-43853407 TACACCAAAGATAGGCCCGGGGG + Intronic