ID: 1129750507

View in Genome Browser
Species Human (GRCh38)
Location 15:78059581-78059603
Sequence CACCTCAAGCAGAATGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129750507_1129750511 0 Left 1129750507 15:78059581-78059603 CCATCCACATTCTGCTTGAGGTG 0: 1
1: 0
2: 0
3: 14
4: 216
Right 1129750511 15:78059604-78059626 GGAATGCAGTCCTTGACAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129750507 Original CRISPR CACCTCAAGCAGAATGTGGA TGG (reversed) Intronic
900560317 1:3301948-3301970 TAGCTCCAGCAGAATTTGGAGGG + Intronic
901177083 1:7311948-7311970 AACCTCAAGCAGCATATGCATGG - Intronic
902758939 1:18568243-18568265 AAGCTCAAGCAGCCTGTGGAGGG + Intergenic
909462900 1:75939667-75939689 AACCTAAAGCAGAATGATGATGG - Intergenic
909567353 1:77068098-77068120 CACCTCTACCAGAATGTGAAGGG + Intergenic
910930292 1:92436702-92436724 CACCTCACCCAGAAAGTGCAAGG - Intergenic
911286908 1:96006051-96006073 AACATCAACCAGCATGTGGAAGG - Intergenic
913224506 1:116687168-116687190 CTCCACAGGCAGAATGGGGAGGG - Intergenic
913566950 1:120081689-120081711 CACAACAATCAGAATGTGCAGGG - Intergenic
913631180 1:120711860-120711882 CACAACAATCAGAATGTGCAGGG + Intergenic
914287702 1:146242395-146242417 CACAACAATCAGAATGTGCAGGG - Intergenic
914548736 1:148693141-148693163 CACAACAATCAGAATGTGCAGGG - Intergenic
914617944 1:149378573-149378595 CACAACAATCAGAATGTGCAGGG + Intergenic
915454343 1:156029545-156029567 CACCCCAAGTTGAAAGTGGATGG + Intergenic
922253132 1:223868301-223868323 CAGCTAAAGCAGAATTTAGAGGG - Intergenic
924097642 1:240570484-240570506 CAAATTAAGCAGAATATGGAAGG + Intronic
924299277 1:242620813-242620835 CTCCTCATGGACAATGTGGAGGG - Intergenic
1065664936 10:28048968-28048990 CATCTCAAGCAGAAAGATGAGGG + Intergenic
1067023920 10:42827199-42827221 CACCTCATGGGGAAAGTGGAAGG - Intronic
1070870294 10:79745369-79745391 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1071565689 10:86670274-86670296 CACCTCATGCAAAGTGTGCAAGG - Intronic
1071637213 10:87267589-87267611 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1072584644 10:96770666-96770688 CACCTCATCAAGAATTTGGAGGG + Intergenic
1075557468 10:123444020-123444042 CACCCCAAGAAGAGTGTGGCAGG - Intergenic
1078249721 11:9607141-9607163 CAGTTAAAGCAGAAAGTGGAGGG + Intergenic
1081115432 11:39193418-39193440 CTCCTCAACAAGAATGTGGCAGG - Intergenic
1083108228 11:60379103-60379125 CTCCTCAAGGCGAATGTGGAAGG + Intronic
1083592308 11:63902941-63902963 CACCTGAAGCAGACAGTGGTAGG - Intronic
1084420820 11:69059652-69059674 CACCTGAAGCAGCATTTGCAGGG + Intronic
1085126398 11:74005421-74005443 CACCACAGGCAGGATGTGGTAGG - Intronic
1087325982 11:96724316-96724338 CATCTAAAGCAGTATGTAGAGGG - Intergenic
1089864306 11:121618300-121618322 CACCCCAGGAAGTATGTGGAGGG - Intronic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091686537 12:2566653-2566675 AACCACAGGCAGAAGGTGGAGGG + Intronic
1092581761 12:9849851-9849873 CACCTCAACCAGCAAGTGTAAGG - Intergenic
1093125269 12:15321853-15321875 CACCTGAAGCTGAATATAGAAGG - Intronic
1093489150 12:19684887-19684909 CCATTCAAGCAGAATATGGATGG + Intronic
1093859135 12:24141961-24141983 AACCTCAAGCAGACTTTGTAAGG - Intergenic
1095345552 12:41144822-41144844 GACCTCAAGGAGAAAGGGGAAGG - Intergenic
1095574490 12:43720088-43720110 CACTTAAAGCAGCATGTAGAGGG - Intergenic
1098051561 12:66459302-66459324 CACCCAAAGTAGAATGAGGATGG - Intronic
1099081350 12:78186462-78186484 CAGCTCAAGCAGAAAGTTGATGG - Intronic
1099495347 12:83339829-83339851 CACCACAAGCAGATTGAAGAAGG + Intergenic
1100041765 12:90328282-90328304 CATCTCAAGCAGACTGTCGGGGG - Intergenic
1100124472 12:91407034-91407056 CATCCAAAGCAGAATGTGGCTGG + Intergenic
1100996424 12:100305494-100305516 CAGCTAAAGCAGTATGTAGAGGG + Intronic
1101259545 12:103014093-103014115 CATTTCCAGCAGAATGTGCACGG + Intergenic
1103786341 12:123436116-123436138 CACCTCAGGAAGGAGGTGGAGGG - Exonic
1104264764 12:127220864-127220886 CACCCCAAGCCGAAAGTGTAGGG - Intergenic
1104269568 12:127270737-127270759 CCACTCAAGCAGATAGTGGAGGG - Intergenic
1106158918 13:27183428-27183450 GATCTCAAGCAGTATGGGGATGG - Intergenic
1107473535 13:40713120-40713142 CACCTCACCCAGAAAGTGCAAGG - Intergenic
1113070143 13:106412314-106412336 CACCACAGGCTGAGTGTGGAAGG - Intergenic
1113106094 13:106772786-106772808 CACCTCAACGAGAATGAAGAGGG - Intergenic
1113821974 13:113221111-113221133 CACCAGAAGCAGAGCGTGGAGGG + Intronic
1114030031 14:18570231-18570253 CATTTAAAGCAGTATGTGGAGGG + Intergenic
1116785636 14:49285480-49285502 CACCCCAATCTGAATGGGGAAGG + Intergenic
1117031650 14:51677870-51677892 CAAATCAACCAGAATGTAGAAGG - Intronic
1120709893 14:87781956-87781978 CTCCTCAAGCAAACAGTGGAGGG - Intergenic
1122155239 14:99746727-99746749 CACCAGCAGCAGAATGGGGATGG - Intronic
1122427547 14:101620614-101620636 GCCCTCAGGCAGGATGTGGATGG + Intergenic
1123410740 15:20056775-20056797 CAGCTCTAGCACACTGTGGAGGG - Intergenic
1123507597 15:20960345-20960367 AACCTCAAGCAGTACGTTGATGG - Intergenic
1123520069 15:21063481-21063503 CAGCTCTAGCACACTGTGGAGGG - Intergenic
1123564818 15:21534088-21534110 AACCTCAAGCAGTACGTTGATGG - Intergenic
1123601076 15:21971381-21971403 AACCTCAAGCAGTACGTTGATGG - Intergenic
1126912907 15:53434002-53434024 CCCCCCAAACAGAATATGGAAGG - Intergenic
1127642177 15:60926277-60926299 CACCTGCAGCAGAACCTGGAAGG + Intronic
1129037955 15:72662320-72662342 CACCTGAGGCAGGAGGTGGAAGG + Exonic
1129211934 15:74074911-74074933 CACCTGAGGCAGGAGGTGGAAGG - Exonic
1129398469 15:75266173-75266195 CACCTGAGGCAGGAGGTGGAAGG + Exonic
1129402077 15:75290449-75290471 CACCTGAGGCAGGAGGTGGAAGG + Exonic
1129607949 15:77033986-77034008 CACCTGAAGCAGTATCAGGAAGG + Intronic
1129729060 15:77919225-77919247 CACCTGAGGCAGGAGGTGGAAGG - Intergenic
1129750507 15:78059581-78059603 CACCTCAAGCAGAATGTGGATGG - Intronic
1130742411 15:86615106-86615128 CACATTAAGCAGCATGTTGAGGG + Intronic
1202973184 15_KI270727v1_random:261200-261222 AACCTCAAGCAGTACGTTGATGG - Intergenic
1132935479 16:2478408-2478430 CACCCCATGCAGAGTGTGGAGGG + Intronic
1137335441 16:47544239-47544261 CACTTAAAGCAGTATGTAGAGGG - Intronic
1143520414 17:7441185-7441207 CAGCTCAACCAGAAGGGGGAAGG - Intronic
1143679357 17:8464918-8464940 CTCCTCAAGCAGGTTGAGGATGG - Intronic
1145190566 17:20840574-20840596 TACCTCCAGCAGAATGTGATTGG - Intronic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1147258312 17:39195091-39195113 CACCTCAGGAGGAATGTGCAGGG - Intronic
1148700756 17:49585409-49585431 CACCAACAGCAGAATGTAGATGG - Intergenic
1150152440 17:62821542-62821564 CACCTCATGCAGCACGAGGAGGG - Intergenic
1150822025 17:68442829-68442851 CACCTCAGACAGACTGTTGAAGG + Intronic
1155523262 18:26690546-26690568 CACATCAAGCATACTTTGGATGG + Intergenic
1156595413 18:38542730-38542752 CACATGAAGCAGAATGAGGGAGG - Intergenic
1156842092 18:41620891-41620913 GAATTCAAGCAGAAAGTGGATGG + Intergenic
1157415628 18:47500304-47500326 CACCTACAGCAGATTATGGATGG + Intergenic
1159240535 18:65737602-65737624 GACCTCAAGCTGAATGTAAAAGG + Intergenic
1165564906 19:36716757-36716779 CACTTCAAGCACAATCTGTAGGG - Intronic
1167534923 19:50043795-50043817 GACTTAAAGCAGAATGGGGATGG + Intronic
925028717 2:632234-632256 CAGCTAAAGCAGTATGTAGAGGG + Intergenic
925360676 2:3278277-3278299 CACCACATGCAGACTGTGGTTGG + Intronic
925922111 2:8645122-8645144 CTCCTCAAGCCGAGTGAGGAGGG + Intergenic
926638743 2:15212398-15212420 CACCAAAAGAAGAAAGTGGAAGG - Intronic
927027906 2:19089435-19089457 CACCTCATGCAGGAAGTGCAAGG + Intergenic
928361451 2:30665174-30665196 CCCCTCCAGCAGATGGTGGAGGG + Intergenic
929695409 2:44110680-44110702 CACATGAAAAAGAATGTGGATGG + Intergenic
930576693 2:53159243-53159265 GACCTCAAGCAGAAAGTTGTGGG - Intergenic
930860065 2:56062808-56062830 CATTTAAAGCAGTATGTGGAGGG - Intergenic
932498214 2:72158172-72158194 CAACTCATGGAGAATGGGGAGGG - Intergenic
933352164 2:81167965-81167987 CACTGCAAGCAAAATGTGGCTGG + Intergenic
933934016 2:87185892-87185914 AACATAAAGCAGAATATGGATGG - Intergenic
936359127 2:111780003-111780025 AACATAAAGCAGAATATGGATGG + Intronic
936834084 2:116685899-116685921 CTCCCCAAAGAGAATGTGGAAGG + Intergenic
938304833 2:130246062-130246084 TTCCTCAAGCAGATGGTGGAAGG + Intergenic
938449180 2:131401138-131401160 TTCCTCAAGCAGATGGTGGAAGG - Intergenic
938807473 2:134819821-134819843 CAACTAGAGTAGAATGTGGAGGG + Intergenic
940007373 2:149020363-149020385 CACCTCAAGGAGAGTGAGAAAGG - Intronic
940980919 2:160002287-160002309 CAACTCAAGCAGCACTTGGAAGG + Intronic
941005880 2:160246443-160246465 CAAGTCAAGTAGAACGTGGAAGG - Intronic
941519786 2:166526582-166526604 CACCCCAATAAAAATGTGGAAGG + Intergenic
941630944 2:167883506-167883528 CACCTCCACCAGATTGTGGATGG - Intergenic
942407144 2:175668196-175668218 CACCTCACCCAGAAAGTGAAAGG + Intergenic
942576699 2:177371356-177371378 CAGCTAAAGCAGCATGTAGAGGG - Intronic
942676571 2:178433140-178433162 AGCCTCAAGCAGAAGCTGGAGGG - Intronic
945529467 2:210932496-210932518 GACCTAAATCAGTATGTGGAAGG + Intergenic
945976788 2:216277359-216277381 TACTTCAAGCAGGATGTGCATGG - Intronic
948507612 2:238440470-238440492 CAACACAGGCAGTATGTGGAGGG - Intronic
1172455065 20:35064287-35064309 CACCTCAAGCCAAATGAAGAAGG + Intronic
1173455410 20:43197500-43197522 CAGCTCATGCAGAATGTATATGG - Intergenic
1174060099 20:47826533-47826555 CACCCCAAGCAGGAGGTGGCAGG + Intergenic
1174202219 20:48814693-48814715 CACCTCCAGCAGAGTGAGGATGG + Intronic
1174761162 20:53208534-53208556 CAAGTCAAGCAGGATGTGGGTGG - Intronic
1175022617 20:55866438-55866460 CACCACAAGCAGAATTTTTATGG - Intergenic
1176121511 20:63456224-63456246 CCCTTCAACCAGAATGGGGAAGG - Intronic
1176291539 21:5047971-5047993 GACATAAATCAGAATGTGGAAGG - Intergenic
1177335392 21:19718401-19718423 GACTTCATGCAGAATTTGGAAGG + Intergenic
1178922169 21:36745869-36745891 AACCCCAGGCAGAAGGTGGAAGG + Intronic
1179865716 21:44215670-44215692 GACATAAATCAGAATGTGGAAGG + Intergenic
1180198390 21:46210685-46210707 AACCTCAAGCAGAGCCTGGATGG + Exonic
1180454146 22:15497281-15497303 CATTTAAAGCAGTATGTGGAGGG + Intergenic
1182715171 22:32352543-32352565 CATCTCCTGCAGAATCTGGAGGG - Intergenic
1183027043 22:35073026-35073048 ACACTCAAGCAGCATGTGGAGGG - Intronic
1183191711 22:36325789-36325811 CAGCTCCTGCAGAATGGGGACGG - Intronic
1184884582 22:47334815-47334837 CATCTCACGCAGAGTGGGGATGG + Intergenic
1184910871 22:47533267-47533289 CAGCTCAAGCAGGTTGTAGATGG - Intergenic
949173955 3:1035395-1035417 CACCTCATCCAGAAAGTGCAAGG - Intergenic
951086021 3:18513934-18513956 CATCTACAGCAGAATGTTGATGG - Intergenic
951346941 3:21558306-21558328 CACTTAAAGCAGCATGTGGAGGG - Intronic
953100487 3:39820931-39820953 CAACCCAAGCAGAAAGTGGATGG - Intronic
955476763 3:59344812-59344834 CACCTCAAGAAGAAGGTATATGG - Intergenic
956226218 3:66961999-66962021 CAGCCCAAGCAGAATGGGGAGGG - Intergenic
956423834 3:69112452-69112474 AACCTGAAGCAGAATGTGGGAGG + Intronic
962046778 3:131768613-131768635 CATCTCAAGCAGGATGGGAATGG + Intronic
962197849 3:133379293-133379315 CACCCCAAGCCAAATGAGGAAGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
966900090 3:184476044-184476066 CAGCTCAAGCAGCATTTCGAGGG - Intronic
968268680 3:197382671-197382693 CACATCAAGGAGAAGATGGAAGG - Intergenic
968870567 4:3239962-3239984 CACCTCAAGCACAGACTGGAAGG - Exonic
969101159 4:4769220-4769242 TGCCTCAGGCAGAATGTGGCAGG - Intergenic
973111675 4:46404854-46404876 CACCTCACCCAGGATGTGCAAGG + Intronic
973612652 4:52651279-52651301 CACCTATAACAGAATGTGGAGGG + Intronic
973824744 4:54693731-54693753 CACCTCTTGCAGAATGGTGAAGG - Intronic
974259284 4:59503848-59503870 AACCTCAAGGAGAAGGTGCATGG - Intergenic
975034309 4:69661571-69661593 CACCTCACCCAGAAAGTGCAAGG - Intergenic
976687307 4:87828745-87828767 CTCCTCAAAGAGAATCTGGAAGG - Intronic
978496244 4:109362237-109362259 AACCACAAGCAGCATGCGGATGG + Intergenic
979387854 4:120091059-120091081 AACCTGAAGAAGAATGTTGAGGG - Intergenic
979603283 4:122609290-122609312 CTACTCAAGAAGAATGAGGAGGG + Intergenic
980381490 4:132025524-132025546 CAACTCAAGCAGAGTGAAGACGG + Intergenic
980597211 4:134970003-134970025 CATTTAAAGCAGAATGTAGAGGG + Intergenic
984237733 4:177181124-177181146 AACCAAGAGCAGAATGTGGATGG + Intergenic
984303896 4:177962278-177962300 CACCTTAAGGAGAAAGTGCATGG + Intronic
984556712 4:181222932-181222954 TTCAGCAAGCAGAATGTGGATGG + Intergenic
984748882 4:183252798-183252820 CAGCTTAAGGAGAATGTGAACGG + Intronic
984831657 4:183981158-183981180 ATCCTCAAGATGAATGTGGATGG + Intronic
984921482 4:184768067-184768089 CAACACAAGCATAATGTGGGAGG - Intronic
985088418 4:186339339-186339361 CACCTCCAGTAGAATATGCAGGG - Intergenic
985836130 5:2273184-2273206 CACCGCATGCAGAGGGTGGAGGG - Intergenic
988712877 5:33795712-33795734 CACCTCAGCCCAAATGTGGAGGG + Intronic
991005318 5:61822873-61822895 CCCCTACAGTAGAATGTGGAGGG + Intergenic
994044085 5:95288543-95288565 CAACACAAGCAGAAAGTGAATGG + Intergenic
995785811 5:115826169-115826191 CGCCTCATGCAGGAAGTGGAAGG - Intergenic
997800504 5:136856199-136856221 CACCACATGAAGAATGGGGAGGG + Intergenic
1000087574 5:157901411-157901433 CTCCTGAAGCAGAAACTGGAGGG + Intergenic
1000607289 5:163338581-163338603 CTCCTCAAGCTTAATGTGTAGGG - Intergenic
1001311576 5:170614751-170614773 CAACTCCAGCTGAAGGTGGATGG - Intronic
1001633540 5:173194063-173194085 CAGATGAAGCACAATGTGGATGG - Intergenic
1002833524 6:846013-846035 CACCTTTAGCACAACGTGGAAGG + Intergenic
1004203221 6:13569480-13569502 CACCTCAAGACAAATGAGGAGGG + Intergenic
1004505996 6:16247094-16247116 CCCTTCAATCAGAAAGTGGACGG + Intronic
1004993522 6:21165163-21165185 CTCCTGAAACAGAAAGTGGAAGG - Intronic
1005964082 6:30714150-30714172 CACCTCGGGAAGAATGTGGTAGG - Exonic
1006011921 6:31049644-31049666 CAAATCAACCAGGATGTGGAGGG + Intergenic
1012149207 6:95724741-95724763 CACTTCTAGCAGAATGTTGCTGG - Intergenic
1012305995 6:97658114-97658136 AACCTGAAGCAGAATTTGCATGG - Intergenic
1013920236 6:115394864-115394886 CACCTCACCCAGAAAGTGCAAGG - Intergenic
1018797712 6:167200134-167200156 CACCTCACCCAGAAGGTGCAAGG - Intergenic
1018891965 6:167989158-167989180 CTTCTCCAGCAGAACGTGGACGG + Intergenic
1020507675 7:9014145-9014167 CACCTCATTCAGAATGCTGATGG - Intergenic
1021785831 7:24151653-24151675 CACCTGTGGCAGAATATGGAAGG - Intergenic
1022659791 7:32356111-32356133 CAGCTCAATCAGAAAGTGGATGG + Intergenic
1023416380 7:39937027-39937049 CACCTCCAGCAGCCTGTGCACGG + Intergenic
1025028458 7:55536822-55536844 CACCTCAACCAGACTGGGTACGG - Intronic
1025825632 7:65008270-65008292 CACCCCAAGGAGAATATGCATGG - Intergenic
1025898639 7:65726086-65726108 CACCCCAAGGAGAATATGCATGG - Intergenic
1027677317 7:81176522-81176544 GACATCAAGCAGAATATGGCTGG - Intronic
1028496122 7:91463265-91463287 CACCTCTGGCAGAGGGTGGAGGG - Intergenic
1032949356 7:136889404-136889426 CACCTCACCCAGATTGTAGAGGG - Intronic
1033449148 7:141447537-141447559 CAGAGCAAGCAGAATGCGGATGG - Intronic
1034431102 7:151041560-151041582 CACCTCAAGCAGAGGGAGAACGG - Intronic
1034889519 7:154827677-154827699 CAGCCCAAGCAGAGTGAGGAGGG + Intronic
1035663808 8:1365521-1365543 CAGGTCCGGCAGAATGTGGATGG + Intergenic
1036453575 8:8890687-8890709 CAGCTCCATCAGTATGTGGAGGG - Exonic
1037624959 8:20598580-20598602 AACCTTAAGCAGAGTGAGGAGGG - Intergenic
1038373453 8:27014617-27014639 CACCTCAAGATGAATGCTGATGG + Intergenic
1039580002 8:38657727-38657749 CAGCTCAAGCAGAGTGAGAATGG - Intergenic
1041576710 8:59405678-59405700 CAACTAAAGCAGGATTTGGAGGG - Intergenic
1042766140 8:72323950-72323972 CACTTAAAGCAGTATGTAGAGGG + Intergenic
1043339762 8:79223475-79223497 CACTTAAAGCAGTATGTAGAGGG - Intergenic
1046091466 8:109507767-109507789 TACCTCAAGCAGAATATGAATGG + Exonic
1046879256 8:119290263-119290285 CACCTCACCCAGAAAGTGCAAGG - Intergenic
1047650831 8:126918375-126918397 GACATGAAGCAGAGTGTGGAAGG - Intergenic
1048983985 8:139720915-139720937 CATCTCAAACACAATGTTGAAGG - Intergenic
1049968106 9:797583-797605 CACCTCAAAAAGAAGATGGAAGG + Intergenic
1052053323 9:23874538-23874560 CATATCAGGCAGAATGTGAATGG - Intergenic
1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG + Intergenic
1056867338 9:90240388-90240410 GACCTCAAGCAGCATGAGAACGG + Intergenic
1057138392 9:92711196-92711218 CACCTTCAGGAGAATGGGGAGGG - Intergenic
1058036572 9:100259359-100259381 CACCTCACCCAGAAAGTGCAAGG - Intronic
1058602324 9:106683529-106683551 GACATAAAGCAGAATGTGGAAGG - Intergenic
1058957324 9:109961074-109961096 CACATCAAGTACAATGTGAATGG + Intronic
1187664889 X:21595924-21595946 AACATGAAGCAGAATGTGGTAGG - Intronic
1187674531 X:21702450-21702472 CACCTCCATCAGAGTGAGGAGGG + Intergenic
1188869036 X:35351452-35351474 AACCCACAGCAGAATGTGGAAGG + Intergenic
1201501621 Y:14649672-14649694 TACGTCAATCACAATGTGGATGG + Intronic
1201920945 Y:19232752-19232774 CACCTCAAACAGGAAGTGCAAGG - Intergenic