ID: 1129750836

View in Genome Browser
Species Human (GRCh38)
Location 15:78062333-78062355
Sequence TTAGTGACTTTGAAGTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129750836_1129750839 16 Left 1129750836 15:78062333-78062355 CCAAACAACTTCAAAGTCACTAA 0: 1
1: 0
2: 0
3: 18
4: 194
Right 1129750839 15:78062372-78062394 CACACCACTATAGCTTTGCAGGG 0: 1
1: 0
2: 0
3: 24
4: 234
1129750836_1129750838 15 Left 1129750836 15:78062333-78062355 CCAAACAACTTCAAAGTCACTAA 0: 1
1: 0
2: 0
3: 18
4: 194
Right 1129750838 15:78062371-78062393 TCACACCACTATAGCTTTGCAGG 0: 1
1: 0
2: 2
3: 4
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129750836 Original CRISPR TTAGTGACTTTGAAGTTGTT TGG (reversed) Intronic
900779036 1:4605544-4605566 TTGGTGACCTTGAAGAGGTTAGG - Intergenic
904102666 1:28045799-28045821 TTATGGACTTGGATGTTGTTGGG - Intronic
905114725 1:35628041-35628063 TTGGTGACTTTGCACTTATTAGG + Intronic
906011866 1:42534702-42534724 TTTGAGACTTTGCTGTTGTTTGG - Intronic
909559511 1:76994030-76994052 ATAATGACATTGTAGTTGTTTGG - Intronic
911146149 1:94554303-94554325 TTTCTGAGTTTGAAGTTGCTTGG + Intergenic
911692609 1:100851290-100851312 ATAGTGAGTATGAAGTTCTTGGG - Intergenic
911769779 1:101725363-101725385 TTAGTGACATTTAGGTGGTTAGG + Intergenic
911863019 1:102978950-102978972 TTAGTGTCTTTGGATTTGTCTGG - Intronic
912144863 1:106781090-106781112 TTGCTGACTTTGAGGTGGTTTGG + Intergenic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
916462007 1:165034902-165034924 TTAATGACTTTGACGTTATTAGG + Intergenic
918410061 1:184249249-184249271 TTACTGACTTTGAAGATGGAAGG - Intergenic
920568253 1:206994026-206994048 TTAATTACTTTGATGTTGTTGGG - Intergenic
921113892 1:212068156-212068178 TTAGTGTAGTTGAAGTTGTTTGG + Intronic
923510974 1:234652660-234652682 TTTGTGTGTTTGAAGTTGTTAGG - Intergenic
1064258335 10:13764535-13764557 TTAGTGAGTTTGTTGTTGTTAGG - Intronic
1065487819 10:26251882-26251904 TAAGTGACATTGAAGTGTTTGGG + Intronic
1065867041 10:29923270-29923292 TTTGTGGCATTGAAGTAGTTTGG + Intergenic
1067365435 10:45623715-45623737 TCAGTGACTTTCACATTGTTGGG - Intronic
1067733339 10:48829918-48829940 CTCGTGACTTTGAAGTTTGTTGG + Intronic
1068033351 10:51730579-51730601 CTAGTGGCTTTCAAGTTTTTTGG + Intronic
1069133796 10:64738927-64738949 TAAATGACTTGTAAGTTGTTTGG - Intergenic
1069454675 10:68544790-68544812 TTAGTGCCTTTGCATTGGTTTGG - Intergenic
1071593319 10:86897453-86897475 TTAGGGACTTAGAAGTTTTTTGG + Intronic
1071806008 10:89121857-89121879 TTAGTGAATTTTAAGAAGTTAGG + Intergenic
1073959001 10:108904528-108904550 ATAGTGACCCTGAAGTTGGTGGG - Intergenic
1074388221 10:113034436-113034458 TTAGTGACTTTGGACATGATGGG + Intronic
1075333812 10:121594989-121595011 TGAGTGAATTTAAAGTTGCTTGG - Intronic
1075504481 10:123009569-123009591 TAAGGGACTTCGGAGTTGTTCGG + Intronic
1076504727 10:130964142-130964164 TGGGGGACTTGGAAGTTGTTAGG + Intergenic
1078198197 11:9154641-9154663 AAATTGTCTTTGAAGTTGTTGGG - Intronic
1079881208 11:25929319-25929341 TTAGTTTATTTGAAGTTGTTTGG + Intergenic
1082884242 11:58066800-58066822 TTTCTGACTTTGAAGATGATGGG - Intronic
1087745425 11:101939754-101939776 TTAAAGTATTTGAAGTTGTTTGG - Intronic
1088118777 11:106342927-106342949 TTACTGATTTGGAAGTTGTACGG - Intergenic
1088971738 11:114780155-114780177 TCAGTGGCTTTGAAGCTATTTGG - Intergenic
1089882996 11:121792847-121792869 TTTGTGACTTTGGTGGTGTTTGG + Intergenic
1091144510 11:133265937-133265959 TTATTCACAGTGAAGTTGTTGGG - Intronic
1092704949 12:11272097-11272119 TTAGTGACTTAGAAAAGGTTGGG - Intergenic
1094277274 12:28692213-28692235 TTGCTGCCTTTGAAATTGTTTGG + Intergenic
1095625637 12:44311035-44311057 TTATTGCATTTGAAGATGTTTGG + Intronic
1097789456 12:63798908-63798930 TAAGTCACTTTTAAGCTGTTAGG + Intronic
1099477937 12:83130652-83130674 TTTGTGATTTTTATGTTGTTGGG - Intronic
1099594235 12:84637961-84637983 TTATTGGCTTTGAAGCTGGTGGG + Intergenic
1099734170 12:86546510-86546532 TTTGTGAATTTAAAGATGTTTGG - Intronic
1100557113 12:95706455-95706477 TTACTGATTTTTAAATTGTTTGG - Intronic
1100696360 12:97098290-97098312 ATTGTGAATTTTAAGTTGTTAGG - Intergenic
1106223795 13:27770135-27770157 TTGGGGACTTTGGACTTGTTGGG + Intergenic
1106342100 13:28840092-28840114 TTAGTGATTTTAAATTTGTAGGG + Intronic
1106953661 13:34912143-34912165 TTAGGGCCTTTGGGGTTGTTGGG - Intergenic
1107481387 13:40789158-40789180 TTAGCTACTTTGACCTTGTTGGG - Intergenic
1108662698 13:52600660-52600682 TTAGTTAATTTGACCTTGTTGGG + Intergenic
1108692719 13:52874073-52874095 TAGGTGATTTTGAAGTTGTCAGG + Intergenic
1110172103 13:72513577-72513599 TGAGTGACTTAGAAGTTTTAGGG - Intergenic
1110348512 13:74477841-74477863 TTAGCTACTTGGTAGTTGTTGGG + Intergenic
1110668432 13:78145992-78146014 TTATTTACTTTGAAGTCATTGGG - Intergenic
1111292252 13:86185422-86185444 TGAGTGAATTTGAAACTGTTGGG + Intergenic
1112958344 13:105089799-105089821 TCATTTACTTGGAAGTTGTTGGG + Intergenic
1113819515 13:113203339-113203361 TTTGTGACTTTGAAAATGTCAGG - Intronic
1114072864 14:19128711-19128733 TTAATTACTTTGAATTTGTGAGG + Intergenic
1114089396 14:19271261-19271283 TTAATTACTTTGAATTTGTGAGG - Intergenic
1116898795 14:50342139-50342161 TTTGTGACTTTGGATTTGCTCGG - Exonic
1120326184 14:83030245-83030267 TTAGTAAGTTTTAAGTTGATAGG + Intergenic
1122871058 14:104639272-104639294 TCAGGGACTTTGGAGGTGTTGGG + Intergenic
1123825840 15:24081479-24081501 TGAGTGACTTTGCAGTTATGGGG + Intergenic
1123927451 15:25131527-25131549 TCAGTGACTTTTAAGTCTTTGGG + Intergenic
1124448420 15:29761478-29761500 TTATAGATTTTGAAGGTGTTTGG + Intronic
1126464114 15:48944916-48944938 TTAGGACATTTGAAGTTGTTAGG - Intronic
1126829028 15:52580296-52580318 TTAGAAACTTTGAAGTTGAATGG - Intergenic
1128689373 15:69711653-69711675 GTATTGACTCTGGAGTTGTTGGG - Intergenic
1128693824 15:69745511-69745533 TCAGTGACTCTCAAGTTTTTCGG - Intergenic
1129750836 15:78062333-78062355 TTAGTGACTTTGAAGTTGTTTGG - Intronic
1131989313 15:98077878-98077900 TTACTGACTCTGAAGTTTTGAGG + Intergenic
1135243669 16:20835021-20835043 ATAGTGAATTTTAATTTGTTGGG + Intronic
1136169634 16:28480932-28480954 TTGGTGACTTTGAAGTCAGTGGG - Intronic
1136527582 16:30842114-30842136 TGAGTTACAGTGAAGTTGTTAGG + Intronic
1143555352 17:7656412-7656434 TTGGTGACTTTGAATTTATCTGG + Exonic
1145905095 17:28511944-28511966 TAATTGGCTTTGGAGTTGTTGGG - Intronic
1151088450 17:71407756-71407778 TTAGTGACTATGGTCTTGTTCGG - Intergenic
1157947871 18:52001263-52001285 TCAGTGATTTTAAAATTGTTTGG + Intergenic
1158720989 18:59924365-59924387 TTAGTTAATTTGCAGTTGTTTGG - Intergenic
1159172365 18:64787986-64788008 TTTGAGACTATGAAGTTGTGAGG - Intergenic
1159494714 18:69187550-69187572 TTTGTCATTTTGAAGTTGTTTGG - Intergenic
1160141186 18:76324615-76324637 TTGCTGAGTTTGAAGTTATTTGG + Intergenic
926570343 2:14522566-14522588 GTCCTGACTTTGAATTTGTTTGG - Intergenic
929315424 2:40472239-40472261 TTTGAGACATAGAAGTTGTTAGG - Intronic
929449312 2:42026038-42026060 TCAGTGATTTTGAAGTGTTTGGG - Intergenic
930488494 2:52039107-52039129 GTAATGACTATGAAGTTGTGGGG - Intergenic
931428406 2:62191440-62191462 TTAGTGACCTTGATGTCGTTGGG - Intergenic
931800629 2:65754661-65754683 TCAGTAACTCTGGAGTTGTTCGG - Intergenic
934864695 2:97796812-97796834 TTAGTGTCCTTGAAACTGTTAGG + Intronic
937732196 2:125246668-125246690 TTACTGGCTTTGAAGATGGTGGG - Intergenic
937959974 2:127450260-127450282 TTCGTGACTTTGAATTTGTCAGG - Intronic
938409200 2:131049985-131050007 TTTCTGACTTTGAAATTTTTAGG - Exonic
938681798 2:133699719-133699741 TTGCTGACTTTGAAGTTGGAAGG - Intergenic
940305637 2:152223120-152223142 TTAGTGATTTTGCAGTGCTTTGG + Intergenic
944117830 2:196208358-196208380 TTAGTGAATTTGAAATCTTTAGG - Intronic
944771498 2:202918652-202918674 TAAGTCACTTTGCAGTTGTCAGG + Intronic
945184608 2:207126957-207126979 TTAGTGACTTTTCAGTCTTTGGG - Intronic
948015354 2:234685466-234685488 TTAATGACTTTTAAGATGATGGG - Intergenic
1169732316 20:8799577-8799599 TTAGTTGCTTTAAAGTGGTTTGG - Intronic
1169839649 20:9920867-9920889 GTAGTGCTTTTGAAGTTTTTGGG - Intergenic
1171559268 20:26107992-26108014 TAAGTGAATTTGAAATTTTTTGG - Intergenic
1173262583 20:41450148-41450170 TTAATGATTTTGTAGTTGTTGGG - Intronic
1175601554 20:60278210-60278232 TTAATAACACTGAAGTTGTTTGG - Intergenic
1180491310 22:15851086-15851108 TTAATTACTTTGAATTTGTGAGG + Intergenic
1181081641 22:20419511-20419533 TTAGTGAATTTGTGGTGGTTGGG - Intergenic
1181973004 22:26707421-26707443 TTAGTAACTGTAATGTTGTTTGG - Intergenic
1185357427 22:50382263-50382285 TTATTGACTTTAAAGCTGTTTGG - Intronic
950095566 3:10328218-10328240 TGAGTGTCTATGAAGTTCTTCGG + Exonic
951287267 3:20828534-20828556 TTAGTGAACTTAAAGGTGTTGGG - Intergenic
953528846 3:43719920-43719942 TTAGGGAATTTGTAGTTGTTAGG + Intronic
953553935 3:43927357-43927379 TGAGTGATTTTGAAGTTATCTGG - Intergenic
955640981 3:61083642-61083664 TTAGTGAGGGTGAAGGTGTTGGG - Intronic
956191647 3:66613721-66613743 TTAGTGACTTAGAATCTTTTTGG + Intergenic
956705524 3:71995841-71995863 TTCGTGACCTTGATGTTTTTCGG - Intergenic
962016441 3:131445538-131445560 TTGGTGACTTTGACGATGGTTGG - Intergenic
963399801 3:144783783-144783805 GTAGTCACTTTAAAGTTGTAAGG + Intergenic
963469641 3:145724205-145724227 TTAGTGACATTGATATGGTTTGG - Intergenic
963945567 3:151142346-151142368 TTAATGAGTTTTAATTTGTTGGG + Intronic
963982439 3:151554406-151554428 TTATTTATTATGAAGTTGTTTGG - Intergenic
964594340 3:158406788-158406810 TTATTGACTTTGATCTGGTTTGG + Intronic
964834898 3:160927295-160927317 GTTGTGTCTTTGAAGTTGTCTGG + Intronic
969060192 4:4428000-4428022 ATAGTGACCTTGTAGTTGTCTGG - Intronic
969305014 4:6320828-6320850 ATAGTCATTGTGAAGTTGTTGGG - Exonic
969326072 4:6444592-6444614 TTACTGTCTTTGAAGTGGTGGGG - Intronic
971012868 4:22458392-22458414 TAAGAGTCTTGGAAGTTGTTAGG - Intronic
971420962 4:26473832-26473854 ATGGTGAGTTTGAAGTTGTGGGG + Intergenic
971735719 4:30448496-30448518 TTAGTCACTTAACAGTTGTTGGG - Intergenic
973215554 4:47665632-47665654 TTAGTGACAGTGAAGATGATGGG - Intronic
973251800 4:48068415-48068437 TGAGGGACTTTGAAGGTCTTGGG + Intronic
974481135 4:62444656-62444678 TTATTGAGTTTGAAGTTTTTGGG + Intergenic
975725113 4:77284298-77284320 TAAGTGGCTTAGAAGTTGTCTGG + Intronic
975919291 4:79365020-79365042 GTAGTATCTTTAAAGTTGTTGGG + Intergenic
977187522 4:93958563-93958585 TTTGTGGCTTTAAAGTTTTTTGG - Intergenic
978354894 4:107861493-107861515 TTAAGGACTTTGAAATAGTTTGG + Intronic
982522390 4:156434900-156434922 TTAGTTACCTTTAAGTAGTTTGG + Intergenic
982918225 4:161241740-161241762 TTAGTAACTTTGAGTTTGTGTGG + Intergenic
984423576 4:179555411-179555433 TTGCTGGCTTTGAAGATGTTAGG - Intergenic
984981129 4:185282519-185282541 TCAGTGAGTTTGAGATTGTTGGG + Intronic
985866885 5:2520851-2520873 CTGGTGCCTTTGAAGTTGTCTGG - Intergenic
987543231 5:19281602-19281624 ATAGTGACTTTGAATATGATAGG + Intergenic
988716183 5:33830467-33830489 CAAGTGGCTTTAAAGTTGTTAGG - Intronic
988933907 5:36064082-36064104 TTAGAGACTAAGAAGTTTTTTGG + Intronic
990123241 5:52482373-52482395 TCAGTGATTTTGATGTTGATAGG - Intergenic
991941726 5:71859812-71859834 TGTGAGATTTTGAAGTTGTTAGG + Intergenic
994132415 5:96245843-96245865 TTAATGTCTTTGAACTTCTTAGG + Intergenic
995156616 5:108921966-108921988 CTAGTTAATATGAAGTTGTTAGG + Intronic
995158798 5:108950321-108950343 TTTGAGAATTTGAATTTGTTTGG - Intronic
995307624 5:110672546-110672568 TTTGGAAATTTGAAGTTGTTTGG - Intronic
995400177 5:111732248-111732270 TTATTCAATTTCAAGTTGTTTGG - Intronic
995784085 5:115809721-115809743 TTTGTGGCTTTTAAGTTATTTGG + Intronic
996612598 5:125400623-125400645 TGATTGATTTTGATGTTGTTAGG + Intergenic
997514825 5:134479995-134480017 TTAGTCACTTAGAAGCTGTCTGG - Intergenic
1003684138 6:8283986-8284008 TTAATGACATTGAAGCTGTGAGG - Intergenic
1003912963 6:10759231-10759253 TTAATGGCTTTTAAGTTGTACGG + Intronic
1005399735 6:25419255-25419277 TTAGTGACAAGGAAGTTATTTGG + Intronic
1007095219 6:39208769-39208791 CCAGTGATTTTGAGGTTGTTGGG - Intronic
1007253176 6:40510290-40510312 TATGTGACTTTCAAGTTTTTTGG - Intronic
1008373488 6:50764174-50764196 TCAGAGACAATGAAGTTGTTAGG - Intronic
1009561693 6:65254037-65254059 TTAGAAACTTTGAAGTTCTTAGG - Intronic
1010548397 6:77188189-77188211 TTAGAGACTTTTCACTTGTTTGG - Intergenic
1013157043 6:107502633-107502655 CTAGTAACTTTAAAGTTATTTGG + Intronic
1014181333 6:118387525-118387547 TTAGTGGCTTAGAAGGTTTTGGG + Intergenic
1014308101 6:119767012-119767034 GTAGTGACTATGCAGATGTTTGG - Intergenic
1014405864 6:121049371-121049393 TTAGTGACTATAATGTTGTTTGG + Intergenic
1016135818 6:140540989-140541011 TTCCTGACTTAGATGTTGTTAGG - Intergenic
1016629254 6:146208615-146208637 TTATGCATTTTGAAGTTGTTAGG + Intronic
1018934419 6:168264387-168264409 TTAATGACTTTTAAAATGTTGGG - Intergenic
1020627055 7:10594649-10594671 TCAGTGACTTTGAGGTGATTTGG - Intergenic
1021180533 7:17500383-17500405 CTATTGCCTTTGAAGTTCTTTGG - Intergenic
1022056748 7:26744329-26744351 TTAGTGACATTTCAGGTGTTAGG + Intronic
1023072381 7:36448743-36448765 TTACTGTCATTGAATTTGTTTGG + Intronic
1024452990 7:49570083-49570105 TTTGTGTCTTTGAAATTGTCTGG - Intergenic
1024818371 7:53297386-53297408 TTAATTACTATGAAGTTGATAGG + Intergenic
1027379498 7:77591319-77591341 TTAGAGACTTTGATTTTATTGGG + Intronic
1029694417 7:102203612-102203634 TTAATAACATTGAACTTGTTTGG + Intronic
1030895321 7:115052643-115052665 TTAGTGCCTTTGAAGATGGAAGG + Intergenic
1031226961 7:119051644-119051666 TTAATGGCTATGAAGTTTTTTGG - Intergenic
1031235183 7:119166846-119166868 TTAATTATTTTGTAGTTGTTTGG + Intergenic
1031692503 7:124807113-124807135 TTAGTGATTTTGGATTTGATAGG - Intergenic
1032286788 7:130543821-130543843 TTAGAGACATTGAAGATGATGGG + Intronic
1032462953 7:132125567-132125589 TTTGGGATTTTGGAGTTGTTTGG - Exonic
1032933217 7:136698023-136698045 TTAATGAGTGTGAATTTGTTAGG - Intergenic
1033590831 7:142806857-142806879 TTTGTGAATTTGAAGTTCCTGGG + Intergenic
1034909175 7:154979163-154979185 TTAGTGAGTTAGAAGTTTTGAGG - Intronic
1037282840 8:17262440-17262462 TCAGTGGCTCTGAATTTGTTGGG - Intronic
1038610887 8:29059494-29059516 GTATTGACTTTGAGGTGGTTGGG - Intronic
1040028452 8:42803061-42803083 TTATTGACATTTAAGTTGGTTGG + Intergenic
1042339551 8:67664661-67664683 GAAGTGAGTTTGAGGTTGTTTGG + Intronic
1042983392 8:74555721-74555743 TTTCTGACTTTGATGTGGTTTGG + Intergenic
1043127815 8:76421792-76421814 TAATTGACTTTAAAGTTCTTAGG - Intergenic
1044599133 8:93986107-93986129 AGAGTGGCTTGGAAGTTGTTTGG - Intergenic
1044923702 8:97191196-97191218 TAAATGACTTTGAGGTTGGTGGG + Intergenic
1046710639 8:117507093-117507115 TTAATGACTTTCAAGTTGTCTGG + Intergenic
1048460154 8:134614868-134614890 TTAGAGATTTAGACGTTGTTTGG - Intronic
1048825550 8:138421982-138422004 TTGTTGACTTTGTAGTTGTGTGG - Intronic
1049106346 8:140615893-140615915 TAAGTGACTTTGCAGGTATTTGG - Intronic
1049459572 8:142718732-142718754 ATTGTGACTTTTTAGTTGTTCGG - Intergenic
1050890024 9:10812926-10812948 TTAAGGAATTTGAAGTTGTGAGG - Intergenic
1052983312 9:34465094-34465116 TTAATAACTTGGAAGTTATTGGG + Intronic
1056906819 9:90658385-90658407 TTAGGGAATTCGAAGTTTTTTGG + Intergenic
1057330333 9:94108562-94108584 GGAGTGACTGTGAAGTGGTTGGG + Exonic
1186099833 X:6144309-6144331 TCAGAGTCTCTGAAGTTGTTTGG - Intronic
1187750111 X:22453705-22453727 ACATTGACTTTGAAGTTATTTGG - Intergenic
1188402060 X:29757690-29757712 TTAATAACTTTGATGTAGTTAGG - Intronic
1189669267 X:43390483-43390505 TTAGTGAGTTGGCAGTTCTTGGG - Intergenic
1190653822 X:52593624-52593646 TTATTGATTCTGAAGTTGATTGG + Intergenic
1196005789 X:110835761-110835783 TTAGTGCCTTATAAGATGTTTGG - Intergenic
1196145379 X:112311112-112311134 TTAAGCTCTTTGAAGTTGTTAGG + Intergenic
1197723209 X:129758976-129758998 TTAGTAACTTTTAACTTGATAGG + Intronic
1198712185 X:139517072-139517094 TTTGTGACTTTGAAGATGGAGGG - Intergenic