ID: 1129751459

View in Genome Browser
Species Human (GRCh38)
Location 15:78067717-78067739
Sequence CAGTGTGAGAAGTGGGGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 371}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129751459_1129751464 -5 Left 1129751459 15:78067717-78067739 CCAAATCCCCACTTCTCACACTG 0: 1
1: 0
2: 2
3: 27
4: 371
Right 1129751464 15:78067735-78067757 CACTGGATTCTAGTTCTCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 298
1129751459_1129751468 22 Left 1129751459 15:78067717-78067739 CCAAATCCCCACTTCTCACACTG 0: 1
1: 0
2: 2
3: 27
4: 371
Right 1129751468 15:78067762-78067784 CTCTGCAAAGGCTAAGAAAATGG 0: 1
1: 0
2: 2
3: 32
4: 326
1129751459_1129751465 10 Left 1129751459 15:78067717-78067739 CCAAATCCCCACTTCTCACACTG 0: 1
1: 0
2: 2
3: 27
4: 371
Right 1129751465 15:78067750-78067772 CTCCCAGGCAATCTCTGCAAAGG 0: 1
1: 0
2: 0
3: 15
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129751459 Original CRISPR CAGTGTGAGAAGTGGGGATT TGG (reversed) Intronic
901739609 1:11333746-11333768 CAGGGAGGGAAGTGGGGATGAGG + Intergenic
901755070 1:11436578-11436600 CAGTGTGTGTGGTGGGGTTTGGG + Intergenic
903017728 1:20372185-20372207 CAGTTTGAGAACTGCTGATTTGG - Intergenic
903705380 1:25281746-25281768 GTGGGTGAGAAGTGGGCATTAGG - Intronic
903721848 1:25411584-25411606 GTGGGTGAGAAGTGGGCATTAGG + Intronic
905476632 1:38233341-38233363 CTGTGTGAGAATTGGGGAGGGGG - Intergenic
905587139 1:39129327-39129349 CCTTGTGAGAGGTGGGGATATGG + Intronic
905934343 1:41811723-41811745 GAGGGTGAGAAATGGGAATTTGG + Intronic
906264987 1:44421792-44421814 CAGTGGGAGAGGTGGGGAGTAGG + Intronic
907076925 1:51587438-51587460 CAGTGTGAGAATTGGAGGATAGG - Intronic
907422095 1:54354444-54354466 CAGTGGGTGAAGTGGGGAGGTGG + Intronic
907954752 1:59217442-59217464 CATAGTGAGAACTGAGGATTGGG - Intergenic
908458967 1:64330704-64330726 CAGTATTTGAAGTGGGGATGGGG + Intergenic
908787626 1:67750691-67750713 CAGTGTTATAACTGGGGCTTAGG + Intronic
909637807 1:77836746-77836768 CTGTATGACAAGTGGGGATATGG + Intronic
909975830 1:82045318-82045340 CAGTGTGTTAAGTGGTGATGTGG + Intergenic
911230104 1:95351987-95352009 CAGTGGCAGATGTGGGGGTTGGG - Intergenic
911983391 1:104594100-104594122 GAGTGTGAGAAGTGAGTTTTGGG + Intergenic
912267700 1:108175086-108175108 CAATGTGAGAACATGGGATTTGG + Intronic
912441802 1:109704610-109704632 GAGTGTGAGAAAGGGGCATTGGG - Intronic
912725985 1:112059226-112059248 CTGTGTTAGAAGTTGGGAGTAGG - Intergenic
912993253 1:114510228-114510250 CAGTGAGAGAAGGGGGATTTGGG - Intronic
914278703 1:146149064-146149086 GACTGTAAGAAGTGGGGAATTGG - Intronic
914343289 1:146777591-146777613 CAGTGGGAGAAGTGTGGAGCTGG - Intergenic
914539750 1:148600006-148600028 GACTGTAAGAAGTGGGGAATTGG - Intronic
914907672 1:151760241-151760263 CAGGGTGAAAAGCTGGGATTAGG - Intronic
915340690 1:155175111-155175133 CAGCTGGAGAAATGGGGATTGGG + Intronic
915518479 1:156427909-156427931 GAGTGTTAGAAGTGGGGAGGGGG - Intronic
915535155 1:156530925-156530947 CAGTGTGTGAAGTGGGGAGAGGG + Intronic
915748018 1:158180211-158180233 CAGTGTGAGAAGTGGCGAGTTGG + Intronic
917473022 1:175342263-175342285 CAGGGTGAGAAGTGGGGGCCCGG + Intronic
919694327 1:200558341-200558363 CTGTTAGTGAAGTGGGGATTAGG - Intronic
920715438 1:208335982-208336004 CAGTATGAGAGGTGGGGACAGGG + Intergenic
922329698 1:224563513-224563535 GAGAGTGAGAAGAGGGGATTTGG + Intronic
922570060 1:226629339-226629361 CAGTCTGAGAATTGGCGATGAGG - Intergenic
923796498 1:237162107-237162129 CAGAGTGAGTAGTGGAGTTTGGG + Intronic
924692576 1:246365648-246365670 CAGGGTGGGGAGTGGTGATTAGG - Intronic
1063074837 10:2704637-2704659 CTGGGTGAGATGTGGGGATCTGG + Intergenic
1063243288 10:4193006-4193028 CAGGGTGAGAGATGGGAATTTGG - Intergenic
1064783162 10:18864925-18864947 CCATGTGGGAAGTGGGGCTTGGG - Intergenic
1065086540 10:22184367-22184389 CAGTGTTAGAAGTGGCAATAAGG + Intergenic
1065748794 10:28866298-28866320 CACAGTGAAAAGTGGGAATTAGG - Intronic
1066244605 10:33570384-33570406 CAGTGTGGGCAGTGGGGACCAGG + Intergenic
1067081209 10:43213436-43213458 CAGGGTGAGAAGAGGGGAGGGGG + Intronic
1067361395 10:45582988-45583010 CAGTTTGATAGGTGAGGATTTGG - Intronic
1067382509 10:45787812-45787834 CAGTGACAGAAGTGGGGATGTGG - Intronic
1067890205 10:50128360-50128382 CAGTCACAGAAGTGGGGATGTGG - Intronic
1068055693 10:52010692-52010714 CAATGTCACAAGTGGGGAGTGGG - Intronic
1068674467 10:59755738-59755760 CCTTGTGAGAAGTGGGAAATGGG + Intergenic
1069046319 10:63747343-63747365 GAATATGGGAAGTGGGGATTGGG + Intergenic
1069867578 10:71513224-71513246 CAGTGTGGCCAGTGGGGATGTGG + Intronic
1069917763 10:71797826-71797848 GAGTGGGGGAAGTGGGGATGGGG + Intronic
1070399452 10:76040546-76040568 GAGTGTGAGCAGTGGGGAAGGGG - Intronic
1070713104 10:78697698-78697720 CTGGCTGAGAAGTGGGGACTAGG + Intergenic
1070847696 10:79537415-79537437 CAATGGGAGCAGTGGGCATTTGG - Intergenic
1070926086 10:80222714-80222736 CAATGGGAGCAGTGGGCATTTGG + Intergenic
1072252937 10:93595885-93595907 CAGTGTCAGAGGTGGGGCTGAGG + Intronic
1072326896 10:94307685-94307707 CCTTATGAGAAGAGGGGATTAGG - Intronic
1072548080 10:96456078-96456100 AAATGAGAGAAGTGAGGATTAGG + Intronic
1072661384 10:97365671-97365693 CAATGTGAGACATTGGGATTGGG + Intronic
1073145259 10:101276664-101276686 TGGTGGGAGAAGTGGGCATTAGG - Intergenic
1074080359 10:110163543-110163565 CAGTTTGAGAAGTGCTTATTAGG + Intergenic
1074544152 10:114389354-114389376 CAGGGTGGGAAGTGGGGAGAGGG + Intronic
1074763898 10:116686718-116686740 CAGTGTGGGAAGAGGGGACAAGG - Intronic
1076126456 10:127978006-127978028 CTGTGGGAGAAGTGGGTCTTTGG - Intronic
1076394645 10:130129749-130129771 CAGTGGGAGAAGGGGGGGTGGGG - Intergenic
1076869224 10:133185174-133185196 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869226 10:133185197-133185219 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869228 10:133185220-133185242 CAGTGTGTGCAGTGTGGAATAGG + Intronic
1076869231 10:133185266-133185288 CAGTGTGTGCAGTGTGGAATAGG + Intronic
1076869236 10:133185335-133185357 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869242 10:133185404-133185426 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869244 10:133185427-133185449 CAGTGTGTGCAGTGTGGAATAGG + Intronic
1076869247 10:133185473-133185495 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1077233766 11:1470219-1470241 CAGTGGGGGCAGTGGGGATGGGG - Exonic
1078167343 11:8899922-8899944 CAGCATGAGAAGGGGGGATATGG + Intronic
1078882246 11:15463787-15463809 TAGTGAGAGAAGTGAGGATTGGG + Intergenic
1080429851 11:32188329-32188351 CAGTGTGAGAAGTAATGAGTTGG + Intergenic
1080504483 11:32898949-32898971 CAGTCTGGGAGGTGGGGATAGGG - Intronic
1081044062 11:38250191-38250213 CAGTGTGGCAAGTGGGGGTGGGG + Intergenic
1081977089 11:47242559-47242581 GAGGGTGAGAAGTGGGGAGAAGG + Intronic
1082295814 11:50440093-50440115 GAGTGTGAGAAAGGGGCATTGGG - Intergenic
1082965968 11:58966477-58966499 CAGTGTGTGGAGTGGGAATCAGG - Intronic
1084894361 11:72254672-72254694 CAGGGTGCCAAGGGGGGATTGGG - Intergenic
1085151451 11:74255471-74255493 CAGTGTAAGGGGTGGGGCTTGGG - Intronic
1085775300 11:79360213-79360235 CAGTATGAGAAACTGGGATTTGG - Intronic
1086491152 11:87358882-87358904 CAGTGTGGGATGTGAGGGTTGGG + Intergenic
1088006930 11:104952610-104952632 CTGTATGTGTAGTGGGGATTAGG - Intronic
1089984987 11:122804205-122804227 CTGGGTGAGAGGTGGGGATGGGG + Intronic
1090467885 11:126951467-126951489 CAGTGTGAGAAGGAGGTATCAGG + Intronic
1091787832 12:3253675-3253697 CAGGGTGACAGGTGGGAATTGGG + Intronic
1092010793 12:5110786-5110808 CATTCTGAGTACTGGGGATTAGG - Intergenic
1092126724 12:6079897-6079919 CAGTGTGTGAGGTGGGGAGCAGG - Intronic
1092161672 12:6318490-6318512 AAGTGGGAGAAGAGGGGTTTGGG + Intronic
1095937733 12:47704142-47704164 CATTGTGACAACTGGGGAATGGG + Intronic
1096256430 12:50064813-50064835 CAGAATGAGAAGCTGGGATTAGG + Intronic
1097536372 12:60875544-60875566 CAGTCTGAGAAGTGAAGAATTGG - Intergenic
1097661133 12:62433092-62433114 CAGTGTTAGGAGTTAGGATTAGG - Intergenic
1098446238 12:70568596-70568618 CTGTGTTAGAAGTGGGCATTCGG - Intronic
1099563783 12:84214352-84214374 CAGAGTGAGTAGTTAGGATTGGG - Intergenic
1100527342 12:95432171-95432193 CAAGGTAAGAAGTGTGGATTTGG + Intergenic
1101232446 12:102755268-102755290 CAGGGTGAGAAGTGGAGAGGTGG - Intergenic
1103030593 12:117609039-117609061 CAAGGTGAGAAGTGGAGATGTGG - Intronic
1103402933 12:120655465-120655487 GGGTGTGAGAGGTGGGGACTGGG - Intronic
1103476205 12:121220790-121220812 GAGTGAGAGAAGTGGGGAATGGG - Intronic
1103907739 12:124335984-124336006 CGGAGTGAGAAGTGGGGGTGTGG + Intronic
1104261597 12:127188282-127188304 CAGAGAGAAAAGTGGGAATTGGG - Intergenic
1104755319 12:131265540-131265562 CAGTGTTGGAAGTGGGGCCTGGG - Intergenic
1107534747 13:41317474-41317496 CAGTGTTAGAAGGGTGGATCAGG + Intronic
1107954789 13:45501139-45501161 CAGTGTGGAAAGTGGGGAAGAGG - Intronic
1108346255 13:49549833-49549855 GAGGATGAGAAGTGGGCATTTGG - Intronic
1110228465 13:73144064-73144086 CAGGGTGAAAAGTTGGGCTTGGG - Intergenic
1111154557 13:84305859-84305881 CCCTGTGAGAATTGGGGCTTGGG + Intergenic
1111219430 13:85184324-85184346 AAGTGTGAGGAGTAGTGATTGGG - Intergenic
1111534140 13:89579366-89579388 CCTTGTGGGAAGTGGGGATTGGG - Intergenic
1111919707 13:94397210-94397232 CAGTGAGAGAAATGGGAAATGGG + Intronic
1112786179 13:102954198-102954220 CAGAGTTAGAAATGGAGATTTGG + Intergenic
1113680450 13:112240084-112240106 CAGTGTTGGAGGTGGGGACTGGG - Intergenic
1113940123 13:114014638-114014660 AAGGTTGAGAAGTGGGGTTTGGG + Intronic
1114398529 14:22388390-22388412 AAGTGTGAGAAGTGGGGAAGTGG - Intergenic
1115250863 14:31345787-31345809 CAGTATGAGAAGTGTGTATGGGG + Intronic
1118074618 14:62284398-62284420 CATTGAGAGAAATGGGGACTTGG + Intergenic
1118411175 14:65479921-65479943 CAGTTTGAGAATGGGGGAATTGG + Intronic
1118642457 14:67805398-67805420 AAGTGAGAGACGTGGGGCTTCGG - Intronic
1118968074 14:70606868-70606890 CAGTGTGTGCAGTGGTGATTTGG - Intergenic
1119087161 14:71749299-71749321 CAGTGAGAGGAGTGGGGAACAGG - Intergenic
1119405373 14:74395442-74395464 GAGTGTGAAAAGAGTGGATTTGG + Intergenic
1121000086 14:90445294-90445316 CTTTGTCAGAAGTGCGGATTTGG - Intergenic
1121302808 14:92885446-92885468 GAGTGTGAGGAATGGGGATCTGG + Intergenic
1121467735 14:94126865-94126887 CAGTGTTGGAAGTGGGGCCTAGG + Intergenic
1121936587 14:98025322-98025344 CAGTGTGATAAGGGGTTATTTGG + Intergenic
1122584608 14:102796518-102796540 TAGTGTCTGAAGTGGGGATGGGG + Intronic
1122769628 14:104092207-104092229 CTGGGTGAGAAGTGGGGACGAGG + Intronic
1122888665 14:104722884-104722906 CAGTGGAAGAAGAGGGGACTGGG + Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1123047252 14:105524999-105525021 CAGTGTGGGACGTGGGCAGTGGG + Intergenic
1125727021 15:41873345-41873367 CTGGGTGGGAAGTGGGGATGGGG + Intronic
1127620020 15:60724894-60724916 CAGTGTGAGGAGCGGGGAGGAGG - Intronic
1128079188 15:64846053-64846075 CAGTGTGAAATGTGGGGGTGGGG + Intronic
1128766718 15:70255595-70255617 CAGTGTTGGAGGTGGGGATCTGG - Intergenic
1129322524 15:74782812-74782834 AAGTGGGAGAAGAGGGGAATGGG - Intronic
1129360533 15:75021250-75021272 CAGTATGAGAAGTGGGGGCAGGG + Exonic
1129535794 15:76312705-76312727 CAGTGAGAGAAGAGGGCAGTGGG - Intergenic
1129751459 15:78067717-78067739 CAGTGTGAGAAGTGGGGATTTGG - Intronic
1130317364 15:82808410-82808432 CGGTGTGAGGGTTGGGGATTGGG - Intergenic
1130391514 15:83459942-83459964 CAGGGTGAGAACTGGGGGTGGGG - Intronic
1130726073 15:86440947-86440969 CAGTGTCAGGAGTGGACATTGGG + Intronic
1131759124 15:95600891-95600913 TAGTGTGAGAGGTTGAGATTCGG - Intergenic
1132471787 16:108323-108345 CAGTATAACAAGTGGGGAATGGG - Intronic
1132482410 16:173089-173111 CAGAGTGAGGGGTGGGGTTTGGG - Intronic
1132483258 16:176893-176915 CAGAGTGAGGGGTGGGGTTTGGG - Intronic
1132520299 16:384178-384200 CAGTGGGAGGAGGGGGGCTTGGG - Intronic
1133458314 16:5962796-5962818 CGGTATGAGAAGTGAGGGTTTGG + Intergenic
1135652461 16:24218234-24218256 AAGTGTGACTTGTGGGGATTGGG + Exonic
1135909419 16:26545644-26545666 CAGTGAGAGAAGTGTGGGGTGGG + Intergenic
1136373536 16:29850806-29850828 CAGCATGAGAAGTGGGCCTTAGG - Intergenic
1137500279 16:49005664-49005686 CAGAGTGAGAAGGGTGTATTTGG + Intergenic
1137692787 16:50441109-50441131 CAGTGGGAGAAGTGTGGCTGGGG + Intergenic
1138707911 16:58936673-58936695 AAGAGTGTGAGGTGGGGATTTGG + Intergenic
1138768416 16:59632040-59632062 CAGAGGGAGAAGTGGGGAGAGGG + Intergenic
1139345548 16:66300723-66300745 CAGTGTGAGATGTGGTGGGTTGG - Intergenic
1139990699 16:70937736-70937758 CAGTGGGAGAAGTGTGGAGCTGG + Intronic
1140111982 16:72012360-72012382 CCAAGTGAGCAGTGGGGATTTGG + Intronic
1140112843 16:72018372-72018394 CAGTGTCAGATTTGGGGAATAGG + Intronic
1140145764 16:72306416-72306438 TAGTGTGAGAGGTGGGGTTCTGG + Intergenic
1140262283 16:73390792-73390814 CAGGGGGAGAAGTGGGTGTTTGG - Intergenic
1141028303 16:80568344-80568366 GAGTGGGAGACGTGGGGATGTGG - Intergenic
1141157417 16:81606951-81606973 CAGTGTGAGGAGTGTGGAAAGGG + Intronic
1141431737 16:83973674-83973696 CAGGTTGAGAGGTAGGGATTTGG + Intronic
1141688953 16:85585842-85585864 CTGTGTGAGGAGTGTGGACTTGG + Intergenic
1142224437 16:88870696-88870718 CAGTGTGTGACGTGGGGCTGGGG - Intergenic
1142950988 17:3479923-3479945 CATTGTGGGAAGTGGGGAGAGGG + Intronic
1143274502 17:5700053-5700075 CAGTGTCAGAAGAGGGGGTGGGG + Intergenic
1144128941 17:12227249-12227271 GAGTGGGAGAAGTGGGGAGATGG - Intergenic
1144620890 17:16817942-16817964 CATTGTTAGGAGTGGGGATGGGG - Intergenic
1145347418 17:22049788-22049810 CAGTCTGGGAAGAGTGGATTTGG + Intergenic
1145894646 17:28447390-28447412 CAGTGTGAAAAGTGGCCATGGGG + Intergenic
1145900168 17:28485450-28485472 CAGCTCTAGAAGTGGGGATTTGG - Intronic
1147319278 17:39636310-39636332 CGGTGAGAGAAGTGGTGACTTGG - Exonic
1148230116 17:45927527-45927549 CAGTGGGAGAGGTGGAGATATGG - Intronic
1148648062 17:49230509-49230531 GAGTGTAAGAAGTGGGGAAGGGG + Exonic
1149106613 17:52975063-52975085 TAGTGTGAGCAGTGGGGAAAAGG + Intergenic
1149552111 17:57548114-57548136 CAGTGTGTGTAGAGGGGTTTGGG + Intronic
1149775654 17:59354892-59354914 CAGTGAGAGAAGAGAGGAGTTGG + Intronic
1149938681 17:60838428-60838450 AAGAGGGAGTAGTGGGGATTAGG + Intronic
1151901837 17:77021085-77021107 CAGTGTTAGAGGTGGGGCCTAGG + Intergenic
1153197029 18:2611611-2611633 CTGTGTGAAGAGTGGGGATGAGG - Intronic
1153382094 18:4451901-4451923 AACTATGAGAAGTGAGGATTGGG + Intronic
1154403181 18:14062233-14062255 CAAGGGGATAAGTGGGGATTCGG - Intronic
1158362133 18:56687113-56687135 CATTTTGAGAAGTTGGGACTTGG + Intronic
1158951253 18:62497473-62497495 CAGAGTGAGAAGTGGAGATGGGG + Intergenic
1161209036 19:3056805-3056827 CAGGGTGAGATCTGGGGCTTGGG - Intronic
1161466108 19:4431482-4431504 TCGTTTGGGAAGTGGGGATTTGG + Intronic
1161901275 19:7121426-7121448 CAGCGTGAGATGTGAGGATGAGG - Intronic
1163942437 19:20507727-20507749 GAGTGTGAGAAAGGGGCATTGGG + Intergenic
1164335978 19:24321663-24321685 GAGTGTGAGAAAGGGGCATTAGG - Intergenic
1164336301 19:24324382-24324404 GAGTGTGAGAAAGGGGCATTGGG - Intergenic
1166381382 19:42357000-42357022 CAGTGTGAGGGCTGGGGAGTGGG - Intronic
1166391000 19:42408900-42408922 CAGAGTGAGCAGTGGGGAGAGGG + Intronic
1166543917 19:43623059-43623081 CAGTGAGGGCAGTAGGGATTGGG - Exonic
1166971921 19:46574628-46574650 CAGTGTGTGGCGTGGGGGTTGGG - Intronic
1168589663 19:57622396-57622418 GAGTGTGAGTAATTGGGATTGGG + Exonic
925312124 2:2892208-2892230 CAGTGTTGAAAGTGGGGCTTGGG - Intergenic
925995042 2:9285349-9285371 CAGTGTTTGAAGTGGGGATGGGG - Intronic
927064919 2:19461691-19461713 GAGTGTGAGGAGTGGGGGCTAGG - Intergenic
929128674 2:38544394-38544416 GAGAGAGAGAAGTGGGGATGTGG - Intergenic
929314830 2:40464666-40464688 CAGTCTGAGAAGTGGGGATGTGG + Intronic
929423868 2:41823919-41823941 CAGTATAAGATGTGAGGATTAGG - Intergenic
929578053 2:43064949-43064971 CATAGAGAGAAGGGGGGATTGGG + Intergenic
929662089 2:43797144-43797166 CAGTGTGTGTATTGGGGATGGGG + Intronic
930031494 2:47060833-47060855 CTGAGTGAGAAGTGGGGAAGAGG - Exonic
930634969 2:53794428-53794450 CCTTGTGACAAGTGGGGATGAGG + Exonic
930878095 2:56242598-56242620 CAGTGTTGGAGGTGGGGACTTGG - Intronic
931780127 2:65572303-65572325 CTTTATAAGAAGTGGGGATTAGG + Intergenic
931889477 2:66655326-66655348 CAGTGTTTGAAGATGGGATTTGG - Intergenic
933014971 2:77113626-77113648 GAGTGTGAGAAAGGGGCATTGGG + Intronic
933633733 2:84683986-84684008 CTGTGTGAGAACTGTGCATTAGG - Intronic
933912702 2:86957310-86957332 CAGTGGGAGGAGAGGGGATGTGG + Intronic
934010293 2:87812580-87812602 CAGTGGGAGGAGAGGGGATGTGG - Intronic
935773857 2:106453300-106453322 CAGTGGGAGGAGAGGGGATGCGG - Intronic
935906206 2:107842613-107842635 CAGTGGGAGGAGAGGGGATGCGG + Intronic
935929230 2:108105371-108105393 CAGTGTGGAAAGGGGGGATTGGG + Intergenic
935992674 2:108735136-108735158 CAGTGGGAGGAGAGGGGATGCGG + Intronic
937936145 2:127247141-127247163 GACTGTGAGAAGTGGGGAGGCGG - Intergenic
938339217 2:130524178-130524200 CAGGGTGGGAAGTGGGGTTGGGG - Intronic
938350620 2:130596572-130596594 CAGGGTGGGAAGTGGGGTTGGGG + Intronic
938730278 2:134141957-134141979 CAGTGTGAAAAGGAGGGAATAGG + Intronic
941897564 2:170644768-170644790 CAGTGTGACAGTTTGGGATTAGG + Intronic
942367659 2:175244765-175244787 AAGAGTGAGAAGTGGAAATTTGG + Intergenic
944377949 2:199070074-199070096 CAGTGTGAGAAATGTTGATTTGG - Intergenic
944771569 2:202919474-202919496 CAGATTGAGAAGTGGAGTTTAGG - Intronic
946341400 2:219071581-219071603 CAGAGTTAGAATTGGGGAGTAGG - Intergenic
947644162 2:231726020-231726042 CCGGGTGAGAATCGGGGATTTGG - Intergenic
1169390710 20:5188692-5188714 AAGTGTGAGAAGTGTGGCATTGG + Intronic
1170233809 20:14079846-14079868 CAGTCTGAGACCTAGGGATTGGG - Intronic
1173247789 20:41348261-41348283 CAGTGAGGGATGTTGGGATTGGG + Intronic
1173361230 20:42346369-42346391 CAGTGTGACAGGTGGGGCGTGGG + Intronic
1173398370 20:42702056-42702078 AAGTGTGACAAGTGGGAAGTGGG - Intronic
1173870930 20:46341707-46341729 CAGGCTGGGAAGTGGGGATGGGG + Intergenic
1174157007 20:48521971-48521993 CAGTGTGATAAGAGGGGCCTTGG - Intergenic
1174161228 20:48551977-48551999 CAGTGCGGGAACTGGGTATTTGG - Intergenic
1174478407 20:50813776-50813798 CTTTGTGAGAAGCGGGGATGTGG + Intronic
1175668740 20:60882769-60882791 CAGTGTGAGGAATGGGTCTTGGG - Intergenic
1175954532 20:62602630-62602652 CACTGAGAGAGGTGGGGTTTGGG - Intergenic
1177799072 21:25809568-25809590 CAGTGGCAGTTGTGGGGATTGGG + Intergenic
1177862653 21:26473243-26473265 AATTGTGAGTAGTGGGGTTTGGG - Intronic
1178579548 21:33826703-33826725 CAGAATGAAAAGTGGGGCTTTGG + Intronic
1178924194 21:36761529-36761551 CAGTGGGAGAGGGGTGGATTTGG + Intronic
1179190661 21:39119249-39119271 CAGTGCGAGAACAGAGGATTTGG + Intergenic
1179427128 21:41290461-41290483 CACTGTGAGAAGGAGGGATACGG + Intergenic
1180991100 22:19936729-19936751 GAGTGTGAGAAAGGGGCATTGGG - Intronic
1181300344 22:21875547-21875569 CAGGGAGAGAAGAGGAGATTAGG - Intergenic
1181305765 22:21916482-21916504 CAGTGTGGCAAGTGGGGGTGGGG - Intergenic
1181648767 22:24247597-24247619 AGGTCTGAGGAGTGGGGATTGGG - Intergenic
1182480515 22:30605989-30606011 CTGTGTGAGAAGAGAGGGTTAGG - Intronic
1183314043 22:37127572-37127594 CAGGCTGAGAAGTGGGGCTGAGG + Exonic
1185318498 22:50189557-50189579 CAGTGCCAGCACTGGGGATTTGG + Intronic
949515458 3:4803234-4803256 CAGTGTCAGAGGTGGGGCCTGGG - Intronic
950214253 3:11147131-11147153 CAGTGTGAAAAGTGGGACTGTGG - Intronic
951180337 3:19652258-19652280 CAATGGGAGCAGAGGGGATTAGG + Intergenic
952221119 3:31325249-31325271 CAGTGTGGAAAGTGCGGAATTGG + Intergenic
953606987 3:44418756-44418778 CAGTGGCAGGAGTGGGAATTGGG - Intergenic
953677637 3:45015726-45015748 CAGTGAGGGTAGTGGGGATGAGG - Intronic
955512114 3:59691763-59691785 AAGTTTGAGAAGTGGGGTATGGG - Intergenic
955895091 3:63690682-63690704 CAGTGGAAGAAGTGGGGAATGGG - Intergenic
956601656 3:71029075-71029097 CAGTCTGTGAACTGGGGTTTGGG + Intronic
956973997 3:74559146-74559168 CAGTGTCAGAACTGGGGTTTAGG - Intergenic
957017058 3:75078814-75078836 CCCTGTGAGAATTGGGGTTTGGG + Intergenic
957275273 3:78083093-78083115 TGGGGTGAGAAGTGGGGCTTGGG - Intergenic
957353387 3:79053669-79053691 CAGTGTGAGAAAGGGGTATTGGG - Intronic
959502398 3:107121406-107121428 AAGTGTGTGAAGTGGGGAGCAGG - Intergenic
964136572 3:153351521-153351543 CAGTGGGATAAATGGGGAGTTGG + Intergenic
966518408 3:180845954-180845976 CAGTCAGAGAAGTTGGGAATGGG + Intronic
967107603 3:186266940-186266962 CAGAGTGAGATGTGAGGAATGGG + Intronic
967242620 3:187456013-187456035 CAGAATGAGACGTGGGGATGTGG + Intergenic
968901914 4:3435976-3435998 CAGTGTGGTGAGTGGGGAATAGG - Intronic
969218536 4:5743598-5743620 CACTGTGAGATCTGGGGGTTTGG + Intronic
969609404 4:8218652-8218674 CTGTCTGAGAAGTGGCGTTTGGG - Intronic
970766229 4:19552019-19552041 CATTGTGAGTACTGGGGGTTGGG - Intergenic
972610542 4:40651815-40651837 GAGTGTAAGAAATGGGGAGTTGG + Intergenic
972756278 4:42050359-42050381 CAGTGGGAGGAGAGGGGATAGGG + Intronic
973803958 4:54506872-54506894 CATCGTGAGAGGTGGGGAGTGGG - Intergenic
975857314 4:78638321-78638343 CAGTGTTAGAAGTGAAGATATGG - Intergenic
976108888 4:81649147-81649169 TAGGGTGAGAAGGGGGGATGTGG + Intronic
976371593 4:84295043-84295065 GAGGGTGAGAGGTGGGGATAGGG - Intergenic
978299324 4:107248738-107248760 CACAGTGAGATGTGGGCATTGGG - Intronic
979549722 4:121977297-121977319 CATTGTGAGTGGTGGGGATGAGG + Intergenic
979857838 4:125656375-125656397 CAGTGTGATGAGTGGTGATGAGG + Intergenic
979995014 4:127421345-127421367 GAGTGGGAGAAGGGAGGATTAGG - Intergenic
981175171 4:141674156-141674178 AATTTTGGGAAGTGGGGATTTGG + Intronic
981948332 4:150375947-150375969 CAGTGTTAGAGATGGAGATTTGG - Intronic
982066282 4:151657471-151657493 CAGAGTGAGGAGTGGGGGTGGGG + Intronic
982238789 4:153277903-153277925 CAGTGTGAGAAGTGGTCATGAGG - Intronic
984132262 4:175892671-175892693 CAGGGTGAGAAGGGGCAATTGGG - Intronic
985268041 4:188168123-188168145 CAATGTGAGCAGTGTGAATTTGG + Intergenic
985638866 5:1053900-1053922 CAGTGTCTGACGTGGGGTTTAGG - Intronic
985715763 5:1460180-1460202 GAATGTGAGAAGTGGGGCTGAGG - Intronic
985783086 5:1881086-1881108 CAGTGTGGGGAGCGGGGATGTGG + Intronic
986767348 5:10939831-10939853 GAGTGTGAGTTTTGGGGATTTGG + Intergenic
988439043 5:31211069-31211091 CTGTGTGTGAAGTGGGTTTTTGG + Intronic
988943574 5:36171093-36171115 CAGTGCCAGAAGTGGGGAGTGGG + Intronic
990327678 5:54694322-54694344 AGGTGTGAGAAGTGGGGGCTGGG + Intergenic
991318760 5:65343507-65343529 TAGAGTGAGAAGTGGGGGTCTGG - Intronic
991929466 5:71738207-71738229 CAGCCTGAGCAGTGGGGTTTGGG - Intergenic
992330985 5:75717321-75717343 CAGAGCGAGGAGTCGGGATTTGG - Exonic
996343645 5:122466425-122466447 CAGGGTTGGAAGTGGGGATGAGG + Intergenic
996548279 5:124704410-124704432 CACTGTGAGATGTCGGGATTGGG + Intronic
996926960 5:128838928-128838950 CAGTGGGTGAAGTGAGGATAGGG + Intronic
998269751 5:140695865-140695887 CTGTGGGAGAAGTCTGGATTTGG + Intronic
998518637 5:142780017-142780039 CAGAGGAAGAAGTGGGGATCAGG - Intronic
999678204 5:154028256-154028278 GAGTGTTATAAGTGGGGGTTTGG - Exonic
1000872399 5:166593068-166593090 GGGTGTGTGAAGTGGGGATAAGG + Intergenic
1001116898 5:168947616-168947638 CAGTGTGAAAAGTGGGGGCCTGG + Intronic
1001220370 5:169895355-169895377 GAGAGTGAGAAGTGGGGTTGAGG - Intronic
1001587107 5:172840400-172840422 CAGGGTGTGAAGAGGGTATTTGG + Intronic
1001679903 5:173548864-173548886 CAGTGTGGCTTGTGGGGATTGGG + Intergenic
1001700521 5:173703435-173703457 CAGAGTGTCAACTGGGGATTGGG - Intergenic
1001708156 5:173757001-173757023 CAGTATGTGCGGTGGGGATTTGG - Intergenic
1002836989 6:873334-873356 CTGTGTAAGAAGAGGAGATTAGG + Intergenic
1002952150 6:1824519-1824541 CATTGTGAGAGGTGGGCATTTGG - Intronic
1004076758 6:12350905-12350927 CAATGTGAGAACAGGAGATTTGG - Intergenic
1005226776 6:23652412-23652434 AAGTGTGAGAAGAGAGGACTGGG - Intergenic
1006916412 6:37596808-37596830 AAGTGTGAAATGTGGGGATGGGG + Intergenic
1006924584 6:37647475-37647497 CGTTGGGAGAAGAGGGGATTGGG + Intronic
1007071667 6:39042633-39042655 TAGTGTCAGAAGTGGGGAGAAGG - Intergenic
1007899186 6:45394322-45394344 CAGTGTTAGAGGTGGGGCCTTGG - Intronic
1009518727 6:64654772-64654794 CAGTGACAGAAGTGGCCATTTGG - Intronic
1009718842 6:67437529-67437551 CATAGTGAGAAATGGGGATCTGG + Intergenic
1012834828 6:104251983-104252005 CCCTGTGACAAGTGGGGACTTGG - Intergenic
1014018841 6:116565393-116565415 CAGTGTGGGCAGCGGGGATGGGG + Intergenic
1016838984 6:148507064-148507086 CAGTTTGTGAAATGGGGAATTGG + Intronic
1017068677 6:150552545-150552567 AAGTGGGAGAAGTGGGGAAGAGG - Intergenic
1018807771 6:167274492-167274514 CAGTGTGAGAAGCAGAAATTTGG - Intronic
1019413440 7:916737-916759 CTGTGTGCCAAGTGGGGGTTGGG + Intronic
1020118991 7:5492273-5492295 CAGTGGCAGATGTGGGGATGTGG + Intronic
1021153206 7:17177041-17177063 CTGTGTAAGAAGTGGGAATTTGG + Intergenic
1021329729 7:19321170-19321192 AAGGGTGAGAAGTTGTGATTGGG + Intergenic
1023300657 7:38767063-38767085 CATTGTGGGAATTGGGGTTTGGG + Intronic
1023484082 7:40665701-40665723 CAGGTTGAGGAGTGGGGATTGGG + Intronic
1024276796 7:47684022-47684044 CACTGTGAGAAGTGGAGCTGGGG - Intergenic
1025728400 7:64088681-64088703 TAGTGTGTGGAGTGGGGAATCGG + Intronic
1026941655 7:74290619-74290641 CTGGGTGAGAAGTGGGGGTCTGG + Intronic
1027007979 7:74712381-74712403 TAGAGAGAAAAGTGGGGATTTGG - Intronic
1027647646 7:80823920-80823942 CAGAGAGAGAAATGGGGAGTAGG + Intronic
1027929195 7:84509245-84509267 GAGTGTGAGCAGGAGGGATTGGG - Intergenic
1028134532 7:87211555-87211577 CATGGTGAGAAGTTGTGATTTGG - Intronic
1029459147 7:100685411-100685433 CAGGGTGGGCAGTGGGGATGGGG + Exonic
1029908861 7:104122360-104122382 CAGTATGAGAAGTAGAAATTTGG - Intergenic
1029921013 7:104263944-104263966 CAATGTGAGAAGGGAGGAATTGG - Intergenic
1031981576 7:128130272-128130294 TATTGTGAGAAGTAGTGATTTGG + Intergenic
1032682902 7:134203695-134203717 CAGTCTACAAAGTGGGGATTGGG + Intronic
1034215814 7:149404848-149404870 CAGTGTGGCAAGTGGGGTTGGGG + Intergenic
1036293477 8:7516380-7516402 CAGTGTGAACAGTTGGGATTTGG + Intergenic
1036329082 8:7804615-7804637 CAGTGTGAACAGTTGGGATTTGG - Intergenic
1037188741 8:16096810-16096832 TAGTATGAGAAATGAGGATTAGG - Intergenic
1037565624 8:20115908-20115930 CAGTGTGAGAAGTGCATATGGGG - Intergenic
1037762744 8:21752682-21752704 AAGTGTGAGATTTGGGTATTAGG - Intronic
1039062394 8:33581954-33581976 CTGGGAGAGGAGTGGGGATTGGG + Intergenic
1041190483 8:55348557-55348579 CAGTGTCAGAAGTGGACATGGGG + Intronic
1041572797 8:59356754-59356776 GAGTGTGAGAATTGTGAATTGGG - Intergenic
1042641488 8:70940168-70940190 CAGTGACAGAAGTGGGGGTAAGG - Intergenic
1042794051 8:72640450-72640472 CAGTCTGAGAAGACAGGATTTGG - Intronic
1043076415 8:75707032-75707054 CTGTGTGAGACTTGGGGCTTAGG + Intergenic
1043744671 8:83859174-83859196 CATTTTGAGAAGTGAGGAATTGG - Intergenic
1045275033 8:100696452-100696474 CAGTCTGAGAGGTGGGGGATGGG - Intronic
1046531512 8:115451964-115451986 AAGTTTTAGAAGTGGGGGTTGGG - Intronic
1047066959 8:121295154-121295176 CAGTTTAAGGAGTGGGGATAGGG + Intergenic
1048242650 8:132758416-132758438 GAGAGTTAGAAGTGGGGTTTTGG + Intronic
1048517155 8:135121571-135121593 GAGTTTTAGAAGTGGGGTTTGGG - Intergenic
1048930680 8:139313379-139313401 CAGTGTGAGAAGCTGCGATGTGG + Intergenic
1049340434 8:142109503-142109525 GAACGTGAGAAGTTGGGATTGGG - Intergenic
1049379926 8:142306988-142307010 CAGTGTTAGAAGTTGGAACTGGG - Intronic
1049571421 8:143371910-143371932 CAGTGTGGAAAGTGGGGCATGGG + Intronic
1049645621 8:143734371-143734393 CAGTGTGTGTGGTGGGGGTTGGG - Intergenic
1053287912 9:36861751-36861773 CAGGGAGGGAAGTGGGGAGTGGG + Intronic
1055442511 9:76350611-76350633 CAGTCTGAAAATTGAGGATTTGG - Intronic
1055955150 9:81766293-81766315 CAGTGGGAGATCTGGGGATGGGG + Intergenic
1057304808 9:93905853-93905875 CAGTGAGAGGAGTGGGGTCTGGG - Intergenic
1057448706 9:95137604-95137626 CAGTTTGAGGTGTGTGGATTTGG + Intronic
1057797493 9:98169336-98169358 CAGTGTCAGATGTGGGGAGGAGG - Intronic
1058298890 9:103345069-103345091 CAGTGTTAGGAGTTAGGATTTGG + Intergenic
1058859321 9:109099262-109099284 CAGTATCAGAAGTGGGGACTGGG + Intronic
1062176959 9:135168728-135168750 CCCTGTGAGAAGGGGGGCTTTGG - Intergenic
1062248601 9:135583187-135583209 CTGTGTAATAAGTGGGGATCAGG - Intergenic
1062694302 9:137865300-137865322 CAGTGAGGGAAGGGGTGATTCGG + Intronic
1187253858 X:17623467-17623489 GCGTGTGGGAAGTGGGGATGGGG + Intronic
1187996756 X:24935075-24935097 CAGTATAAGAAGAGGAGATTAGG - Intronic
1189925590 X:45951003-45951025 CAGTGTGACAATTGGGGCATAGG - Intergenic
1191135851 X:57064124-57064146 CACTGTGGGAAGTGGGGCTTAGG - Intergenic
1191929845 X:66359241-66359263 CAGTGTGAGGTGGGGGGAGTAGG + Intergenic
1192087009 X:68110095-68110117 CAGTTCCAGAAGAGGGGATTTGG - Intronic
1192894722 X:75430000-75430022 CAGTGTGATAAGTGAGGCTATGG + Intronic
1192903140 X:75521854-75521876 CACTGTGGGAGGTGGGGAGTGGG + Intronic
1194068216 X:89288051-89288073 CAGGGTGTGAAATGGGGATGTGG + Intergenic
1196999807 X:121426615-121426637 CACTGTGAGAAGTGAGAATATGG - Intergenic
1197825591 X:130587090-130587112 CAGTGTAAGAAGAAGAGATTAGG + Intergenic
1199331649 X:146567372-146567394 AAGTATGAGAGGTGGGGAATTGG + Intergenic
1199857988 X:151776072-151776094 CAGTGTGGTGTGTGGGGATTTGG + Intergenic
1200525423 Y:4269935-4269957 CAATGTTGGAAGTGGGGTTTGGG - Intergenic
1200722358 Y:6622221-6622243 CAGGGTGTGAAATGGGGATGTGG + Intergenic
1201475800 Y:14379523-14379545 GAGTGTGAGAAAGGGGCATTGGG + Intergenic