ID: 1129752425

View in Genome Browser
Species Human (GRCh38)
Location 15:78075716-78075738
Sequence TTGGTTTTCTTTGGGGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 573
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 523}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129752418_1129752425 0 Left 1129752418 15:78075693-78075715 CCTGTGTAGGACTGCAACCCGAG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1129752425 15:78075716-78075738 TTGGTTTTCTTTGGGGAAACAGG 0: 1
1: 0
2: 2
3: 47
4: 523
1129752416_1129752425 30 Left 1129752416 15:78075663-78075685 CCAAGTTTATACAGGCACTCTCT 0: 1
1: 0
2: 2
3: 8
4: 139
Right 1129752425 15:78075716-78075738 TTGGTTTTCTTTGGGGAAACAGG 0: 1
1: 0
2: 2
3: 47
4: 523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129752425 Original CRISPR TTGGTTTTCTTTGGGGAAAC AGG Intronic
901395275 1:8976611-8976633 TTGGTTTGCTTTCTGTAAACTGG - Intergenic
903102469 1:21043718-21043740 TTGTATTTCTTTGTAGAAACTGG - Intronic
903990964 1:27269154-27269176 TTTTTTTTTTTTGGAGAAACAGG - Intronic
904117430 1:28173095-28173117 TTTTTTTTTTTTGTGGAAACGGG - Intronic
904525364 1:31129497-31129519 TTTGTTTTCTTTTGGAAGACTGG + Intergenic
904670939 1:32165076-32165098 TTGTTTTTTTTTGGAGAGACAGG + Intronic
904672060 1:32173425-32173447 TTGGAGTTCTTAGGGAAAACTGG - Exonic
906503203 1:46357352-46357374 TTGGTATTTTTTGTGGAGACGGG + Intronic
907055484 1:51363343-51363365 TTGGTTTTCTTGAAGGAAAATGG - Intronic
907106088 1:51884137-51884159 TTGTTTTCCTTTTTGGAAACAGG + Intergenic
907153238 1:52308184-52308206 TTTCTTTTCTTTTTGGAAACAGG + Intronic
908026083 1:59952910-59952932 TCGCTTTGCTTTAGGGAAACAGG + Intergenic
908581331 1:65520300-65520322 TGGGTATTCTCTGGGCAAACCGG - Intronic
909408470 1:75320192-75320214 CTGGTTTTCTTTGAGGCAGCTGG - Intronic
909555038 1:76944183-76944205 TTGGTTTTATCTGAGAAAACTGG + Intronic
909696577 1:78474186-78474208 TTGTTTTTTTTTGGAGAGACTGG - Intronic
909789417 1:79655652-79655674 TAGCTTTACTTTGGGTAAACAGG + Intergenic
911029542 1:93471518-93471540 TTTGTATTTTTTGTGGAAACAGG - Intronic
912683702 1:111745471-111745493 ATGGTTTTTTTTGTGGAGACAGG + Intronic
912793004 1:112672042-112672064 CTGGTTTTCTTTTGGGAACCAGG - Intergenic
914384619 1:147156276-147156298 TTGCTTTTAATTGGGGAAATAGG - Exonic
914740553 1:150461277-150461299 GTGGTTTCCTTTGGGGTAACAGG - Intronic
915307593 1:154989558-154989580 AGGGTCTTCTTTGGGGAAAAAGG + Exonic
915339588 1:155169155-155169177 GTCGTGTTCTTTGGGGAAAGGGG - Intergenic
916468323 1:165094471-165094493 TTGGTTTTCTGTGGGGGCAGTGG - Intergenic
917424968 1:174904032-174904054 TTGGTTTTCTGTGGGGGGAGGGG - Intronic
918737090 1:188078337-188078359 TTTTTTTTCTTTTTGGAAACAGG - Intergenic
919151354 1:193704039-193704061 TTGCTTTCCTTTTGGTAAACTGG - Intergenic
919445441 1:197699126-197699148 TTGGTGTTCATTGGGGATATTGG - Intronic
919529775 1:198702431-198702453 GTGGTTGTCAATGGGGAAACTGG - Exonic
919797511 1:201330211-201330233 TTTTTTTTCCTTGGGGAAACTGG + Exonic
920283360 1:204860553-204860575 TCTTTTTTCTTTGGGGAAAAAGG + Intronic
920738423 1:208556931-208556953 TTGGTTTTTTTGGGGGGAAAAGG + Intergenic
921579210 1:216875392-216875414 TTGGTTACCTTTGGGGAAGAAGG - Intronic
921862175 1:220051501-220051523 TTTTTTTTCTTTGTGGAGACAGG - Intergenic
922805979 1:228389719-228389741 TTTTTTTTTTTTGGGGATACAGG - Intergenic
923186555 1:231578958-231578980 TTTTTTTTTTTTTGGGAAACAGG + Intronic
924018040 1:239749237-239749259 TTCTTTTTCTTTGGGGAGAGGGG + Intronic
924083217 1:240420889-240420911 TTGGATTTATTTGGAAAAACAGG + Intronic
924467609 1:244312523-244312545 TTGGTATTTTTTGTAGAAACAGG + Intergenic
924601466 1:245493432-245493454 TTATTTTTCTTTGGTGAAAATGG - Intronic
924816309 1:247445046-247445068 TTGTGTTTCTTTGGGGAATGTGG - Intronic
1063742241 10:8836781-8836803 CTTGTTTTCTTTGGGGAAATAGG - Intergenic
1063949481 10:11208702-11208724 ATGGCTGGCTTTGGGGAAACGGG + Intronic
1064191694 10:13212023-13212045 TTGGGTTTCTGTGTAGAAACTGG + Intergenic
1066380190 10:34894698-34894720 TTTATATTCTCTGGGGAAACAGG - Intergenic
1066408450 10:35142777-35142799 TTTGTTTTCTATGTGGAGACGGG + Intronic
1067454073 10:46402313-46402335 TTGGTTTTCTTTGGGGTTTGGGG + Intergenic
1067633127 10:47982316-47982338 TTGGTTTTCTTTGGGGTTTGGGG - Intergenic
1068188929 10:53624609-53624631 TTGGTTTTCTTTAGGCAAAACGG - Intergenic
1068452881 10:57214721-57214743 ATGTTTTTATCTGGGGAAACTGG - Intergenic
1068611315 10:59063519-59063541 ATGGTTGGCTTTGGGGAAAAGGG - Intergenic
1069065632 10:63939027-63939049 TTGGTTGTCTTTGAGGATAACGG - Intergenic
1069459552 10:68581668-68581690 TTGTATTTTTTTGGAGAAACGGG - Intronic
1070189133 10:74095417-74095439 TTGGTTTTTTTTAGAGAGACAGG - Intronic
1071306261 10:84301705-84301727 GTGGTTATCTTTGGGGGAAAAGG + Intergenic
1072416581 10:95251750-95251772 TTGGTTTTACTGGGTGAAACAGG - Intronic
1072721880 10:97786257-97786279 TTGGGCTCCTTTGGGGAACCTGG - Intergenic
1073752099 10:106540305-106540327 TTTGTTTTCTTTTTTGAAACAGG - Intergenic
1074318351 10:112378941-112378963 TTAGCCTTCTTTGGGGAAGCTGG + Intronic
1075683203 10:124346885-124346907 TTGTTTTCCTTTGTGGAGACAGG + Intergenic
1075740275 10:124691736-124691758 TTGATCTTTTTTGGTGAAACAGG - Intronic
1075803910 10:125171436-125171458 TTGATTTTCCTTGGATAAACTGG + Intergenic
1076315493 10:129537565-129537587 TTTTTTTTCTTTTGGGAAAAAGG + Intronic
1077651302 11:3975197-3975219 TTGGTTTTCTCAGGGTAAAGTGG + Intronic
1079019133 11:16894685-16894707 TAGGTTTTCTGTGGGGAGAAGGG - Intronic
1079457337 11:20648221-20648243 TTGGTTGCCTTTAGGGAAACTGG - Intronic
1080657320 11:34268102-34268124 TTAATTTTTTTTGGAGAAACAGG + Intronic
1080716944 11:34812055-34812077 TAGGTTTTCTTTGGGGAGTTGGG - Intergenic
1081489994 11:43559856-43559878 TTAGGTTTCTTTTGAGAAACAGG - Intronic
1081831396 11:46119497-46119519 TTTGTTTTCATTGGTGAATCTGG - Intronic
1083483796 11:62969024-62969046 TTTGTTTTCTTTGTAGACACAGG - Intronic
1084167151 11:67380602-67380624 TTGTATTTCTTTGTAGAAACAGG + Intronic
1084327276 11:68408256-68408278 TTTTTTTTTTTTGGGGAGACAGG + Intronic
1086263442 11:84969554-84969576 TTTGTGTTCTTTGGGGAACAAGG - Intronic
1087044410 11:93832439-93832461 GTGGTTGTCTTTGGGGAGAATGG + Intronic
1087346538 11:96978725-96978747 TTGGGTTTCTGTTGGGAAAAAGG - Intergenic
1088468393 11:110166213-110166235 TTATTTTTATTTGGGGAAAGTGG + Exonic
1089035948 11:115391625-115391647 TTGTTTTGTTTTGGGGAAAAAGG - Intronic
1089721242 11:120425009-120425031 TTAGTTCTCTGTGGAGAAACAGG + Intronic
1089772908 11:120816183-120816205 TTTGTCTTCTCTGGGGAAAAAGG - Intronic
1091282976 11:134392373-134392395 TTGGTTTTGTTTTGAGAGACAGG + Intronic
1091414336 12:268109-268131 TTTTTCTTGTTTGGGGAAACAGG - Intergenic
1091566711 12:1654166-1654188 TTTTTTTTTTTTGTGGAAACAGG - Intergenic
1092281546 12:7101439-7101461 TTAATTTTTTTTGTGGAAACGGG + Intronic
1092492956 12:8962708-8962730 TTTTTTTTTTTTTGGGAAACAGG - Intronic
1093475937 12:19554381-19554403 TTGGTATTTTTAGTGGAAACAGG - Intronic
1093926555 12:24913925-24913947 ATGGTTGGCTTTGGGGAAAAGGG + Intronic
1094121737 12:26982205-26982227 TTTGTATTTTTTGGAGAAACAGG + Intronic
1094710168 12:32954530-32954552 TTTTTTTTTTTTGTGGAAACAGG - Intergenic
1096349108 12:50879794-50879816 TTGGTATTTTTTGTGGAGACGGG - Intronic
1096449777 12:51728722-51728744 TTTTTTTTTTTTTGGGAAACAGG - Intronic
1096796306 12:54080178-54080200 TTTGTTTTCTTGGGGGAGATGGG - Intergenic
1098884646 12:75948410-75948432 TTTGATTTATTTGGGGAAAATGG - Intergenic
1099416612 12:82395341-82395363 TTGTTTTTCTTTGTTGAAAATGG + Intronic
1100197162 12:92260074-92260096 TTGTTTTTCTCTGGGGCACCTGG - Intergenic
1100632401 12:96401206-96401228 TTTGTTTTCTTGGGGGAGGCGGG + Intergenic
1100985303 12:100197899-100197921 CTGGCTTCCTTCGGGGAAACAGG + Intergenic
1101041414 12:100759747-100759769 TGGGTGTTCCATGGGGAAACGGG - Intronic
1101606820 12:106253212-106253234 TTTGTTTTCTTTTTGGAGACAGG + Intronic
1102379003 12:112447298-112447320 GTGGTTTCCTCTGGGGAAAGAGG - Intronic
1102542912 12:113635196-113635218 TTGCCTTTCTTTTGGGAAGCGGG + Intergenic
1102644910 12:114397555-114397577 TTGTTTTTCTTTGGGGAAGAGGG + Intronic
1103512733 12:121486350-121486372 TTTTTTTTTTTAGGGGAAACGGG + Intronic
1104230149 12:126876848-126876870 TTGTTTTTATTTGTTGAAACTGG - Intergenic
1104637801 12:130448843-130448865 TGGGTTTGCTTTGGTGGAACTGG + Intronic
1105168518 13:17551674-17551696 TTTGTTTCCTTTGGTGAAAAAGG + Intergenic
1105190314 13:17891094-17891116 TTTGATGTCTTTGGGGAAAAAGG + Intergenic
1105297356 13:19100113-19100135 TTTCTTTTCTTGGGGGAAATTGG - Intergenic
1105623358 13:22089991-22090013 TTGTTTTACATGGGGGAAACAGG - Intergenic
1105848552 13:24314364-24314386 TTTTTTTTCTTTGGAGAGACTGG - Intronic
1106321542 13:28644153-28644175 TTGGTTTTTTTTTTAGAAACAGG - Intergenic
1106600648 13:31183654-31183676 TTGTTTTTTTTTGGAGAGACGGG - Intergenic
1107516655 13:41136009-41136031 GTGGTATCCTATGGGGAAACAGG - Intergenic
1107663291 13:42662350-42662372 TTATTTTTTTTTGAGGAAACAGG - Intergenic
1108008680 13:45980271-45980293 TTTGTTTTTTTTGGGGGGACAGG - Intronic
1108157702 13:47603509-47603531 TTGGTTTTCTGTGGGGGAGTGGG - Intergenic
1108449338 13:50545373-50545395 TTGTTTCTCTTTGTGGAAATTGG + Intronic
1109408033 13:61926061-61926083 TTTGCTTTCTTTGGGGAAGAAGG + Intergenic
1109528106 13:63603218-63603240 TTGTATTTCTTTGGGGTCACTGG - Intergenic
1109914496 13:68963035-68963057 TTTGTTGTTTTTGGGGGAACAGG - Intergenic
1111153101 13:84284538-84284560 TTTGTATTTTTTGTGGAAACGGG + Intergenic
1111408834 13:87846703-87846725 TTTGTTTTCTTTTTTGAAACAGG - Intergenic
1111647729 13:91051742-91051764 TTAGTTTTCTTAGAGGAAATAGG - Intergenic
1111993280 13:95137964-95137986 TTTATTTTCTTTGGGGAAAGTGG + Intronic
1112048771 13:95624167-95624189 TGAGTCTTCTTTGGGGAAAACGG - Intronic
1112499072 13:99928608-99928630 TTCTTTTTCTTTTGAGAAACAGG + Intergenic
1112649487 13:101378569-101378591 TTGGGTTTCTTTGGTGCTACAGG - Exonic
1112731899 13:102372510-102372532 TAGATTTTCTCTGGGGAACCAGG - Intronic
1113034042 13:106028904-106028926 TTTGTTTTGTTTTGAGAAACCGG + Intergenic
1113862106 13:113493323-113493345 TTGGGATCTTTTGGGGAAACTGG + Intronic
1113986239 13:114318326-114318348 TTGGTTTTCTTTTTTGAGACAGG + Intronic
1114358949 14:21948737-21948759 TTTGTTTTGTTTTTGGAAACAGG + Intergenic
1115466847 14:33724460-33724482 TTTGTGTTTTTTGAGGAAACAGG - Intronic
1115554307 14:34532284-34532306 TTTGTTTTTTTAGGAGAAACGGG - Intronic
1116039923 14:39673745-39673767 TTCCTTTTCTTTGGGGAAAATGG - Intergenic
1116347488 14:43812942-43812964 GTGGTTTTCTTTGGGGGAGGGGG + Intergenic
1117700377 14:58406655-58406677 TTGTTTTACTTTAAGGAAACAGG - Intronic
1117728787 14:58700462-58700484 TTGATTTTCTTTGTAGAGACAGG + Intergenic
1117746269 14:58872675-58872697 TTGGGTTTCCTTCAGGAAACAGG + Intergenic
1117898989 14:60514481-60514503 GTCGTTTTTTTTGGTGAAACTGG - Intronic
1119221769 14:72914618-72914640 TTTTTTTTTTTTGGAGAAACGGG + Intergenic
1119630564 14:76228290-76228312 TTGGATTCCTTTGGGGGAAGGGG + Intronic
1119981078 14:79081771-79081793 TTGGTTTACTATGAGGAAAATGG - Intronic
1120017206 14:79487564-79487586 ATGCTTTGCTTTGGGGAAACAGG - Intronic
1120662834 14:87270872-87270894 CTGCCTTTCTTTGGGGAAAATGG + Intergenic
1120786230 14:88539599-88539621 TTGCTTTTCTTTTAGGAAAATGG + Intronic
1121423627 14:93832957-93832979 TTTGTTGTCTCTGAGGAAACAGG + Intergenic
1121884819 14:97533508-97533530 TTGGTTTCCTTTGGAGACAACGG - Intergenic
1122112432 14:99511732-99511754 TTGGTTTCCTTTGGAGGACCTGG + Exonic
1122156833 14:99755057-99755079 TTTGTGTTCTTTTGGGAAATGGG + Intronic
1122194250 14:100073325-100073347 TTTTTTTTTTTTGGGGAGACAGG + Intronic
1122579750 14:102764126-102764148 TTTGTTTTCTTTTGGGAATCAGG + Intergenic
1122791325 14:104185352-104185374 TGGGTTTCCTGTGTGGAAACGGG - Intergenic
1122995122 14:105259270-105259292 TTGGATTTTTTTGTAGAAACAGG - Intronic
1123838304 15:24219860-24219882 TTGGTTTTCTTTTTTGAACCAGG - Intergenic
1123847843 15:24322142-24322164 TTGGTTTTCTTTTTTGAACCAGG - Intergenic
1123866887 15:24529517-24529539 TTGGTTTTCTTTTTTGAACCAGG - Intergenic
1124798419 15:32805372-32805394 TTGTTTTTCTTTGTGGATTCTGG + Intronic
1125622601 15:41077319-41077341 TTGTTTTTCTTTTGGGAGAGTGG - Intronic
1125637742 15:41203598-41203620 ATGGCTGGCTTTGGGGAAACTGG - Intronic
1125878360 15:43169222-43169244 TTGGTGTTCTGAGGGGAAAGGGG + Intronic
1126587242 15:50301091-50301113 TTTGTTTTCTTTGGTATAACTGG - Intronic
1126808021 15:52372670-52372692 TTGTTTTTCTTTTGGTAATCTGG - Intronic
1127280444 15:57486304-57486326 TTGTTTCTCTTTGTGGAAATGGG + Intronic
1127515027 15:59685326-59685348 TTTGTATTTTTTGTGGAAACGGG - Intronic
1127604321 15:60570869-60570891 TCTGTTTTCTCTGGGGTAACAGG + Intronic
1128888566 15:71310749-71310771 ATGGTTGGCTTTGGGGAAAAGGG + Intronic
1129420421 15:75420970-75420992 TTTGTTTGCTTTATGGAAACTGG - Intronic
1129752425 15:78075716-78075738 TTGGTTTTCTTTGGGGAAACAGG + Intronic
1129808567 15:78486431-78486453 TTGGTATTTTTTGTGGAGACGGG - Intronic
1129940551 15:79493239-79493261 TTGGCTTTCTCTGGGGAAATAGG - Intergenic
1130196646 15:81785603-81785625 TATGTTGTCTTTGGGGAAAAAGG + Intergenic
1130720916 15:86385568-86385590 TTGGTTTCCCATGGGGAAAGTGG + Intronic
1131811293 15:96176277-96176299 ATGGTTGTCTTTGGGAAAATGGG + Intergenic
1132151440 15:99463605-99463627 TTGTTTTTCTTTGTAGATACAGG - Intergenic
1133035558 16:3032103-3032125 TTTGTTTTCTTAGGAGAGACGGG + Intronic
1134909691 16:18013593-18013615 TTCGTTTTTTTTAGGGAGACAGG + Intergenic
1135077770 16:19409207-19409229 TTGTATTTTTTTGTGGAAACTGG + Intergenic
1135391666 16:22098901-22098923 TTTTTTTTTTTTGTGGAAACAGG - Intronic
1136617634 16:31408410-31408432 CTGGGTTCCTGTGGGGAAACAGG - Exonic
1137630133 16:49937381-49937403 TTGGTTTGCTTTGGGGCCAAGGG - Intergenic
1137855814 16:51793604-51793626 TTGAATTGCTTTGGGAAAACTGG - Intergenic
1138246724 16:55472280-55472302 TTGATTTTTTTTGTGGAGACAGG - Intronic
1138404158 16:56775470-56775492 TAGGTTTTCCTGAGGGAAACTGG + Intronic
1138468371 16:57210843-57210865 TTGGATTTTTTTGTAGAAACAGG - Intronic
1138486318 16:57346596-57346618 TTGTTTGTTTTTGGAGAAACAGG - Intergenic
1138940219 16:61781419-61781441 TTGGTTTTTTTTTTAGAAACAGG - Intronic
1140841374 16:78842495-78842517 TTTGTTTTCTTTTTCGAAACAGG - Intronic
1141740459 16:85888489-85888511 TTGTTTTTTTTTTTGGAAACAGG + Intergenic
1141964021 16:87429348-87429370 TTTTTTTTCTTTGTGGAGACAGG + Intronic
1142652171 17:1361291-1361313 TTGGTTTTGTTTTAGGAAAGGGG - Exonic
1144123212 17:12177196-12177218 TTGGTTTTCTCTGGAGAGAAAGG + Intergenic
1144318561 17:14089219-14089241 TTATTTTTCTTTGGAAAAACTGG - Intronic
1144432235 17:15204178-15204200 TTGTTTTTCTGTGGGGTAAGTGG - Intergenic
1144536154 17:16094072-16094094 TTGTTTTTTTTTGGAGAGACAGG + Intronic
1145377126 17:22361187-22361209 CTGATATTCTTTGGGGAAGCTGG - Intergenic
1145758649 17:27411465-27411487 TTGGTTTTGTTTTAGGAAAGGGG - Intergenic
1146430304 17:32786945-32786967 GTGGTTTTCTTTGGGGGAGTGGG - Intronic
1146809512 17:35892010-35892032 TTGGTTTGCTTTCTGGAAATGGG + Intergenic
1146899400 17:36572515-36572537 TTTGTATTCTTTGGAGAGACAGG - Intronic
1147380020 17:40049167-40049189 TTTGTATTTTTTGTGGAAACGGG - Intronic
1147523664 17:41199475-41199497 ATGTTATTTTTTGGGGAAACTGG - Intronic
1147673252 17:42189054-42189076 AGGGTCTGCTTTGGGGAAACGGG - Intronic
1147859775 17:43512016-43512038 TTGGTTTTCTTTTTTGAGACAGG - Intronic
1148234685 17:45960786-45960808 TGGGTTTTCTTTGGGGGAGTGGG - Intronic
1148497983 17:48065797-48065819 TTGGTTTTTTTTTTGGAGACAGG + Intergenic
1149098870 17:52879346-52879368 TACATTTTCTTTGGGGAAGCTGG + Intronic
1149556455 17:57576879-57576901 TAAGTTTTCTTTGAGGCAACAGG + Intronic
1149574826 17:57704187-57704209 TTTGTATTCTTTGTGGAGACAGG - Intergenic
1150223245 17:63508946-63508968 TGGGTCTTCTTTGGCAAAACGGG - Intronic
1151369944 17:73641585-73641607 TTGGTTTTTTTTGGGGATGGGGG - Intronic
1152072350 17:78140316-78140338 TTTTTTTTTTTTGTGGAAACTGG - Intronic
1152512106 17:80797317-80797339 TTGGTTTTTTTTGTAGAGACAGG + Intronic
1152962832 18:89875-89897 TTGGTTTTCTTTTTGGAGACAGG - Intergenic
1153344175 18:4008171-4008193 TTGGTTCTGTTTGGGGCATCAGG - Intronic
1153538113 18:6124988-6125010 TTGGCTTTCTTTTGGGAAAGAGG - Intronic
1153638203 18:7131396-7131418 TTGTTTTTCAATGAGGAAACAGG + Intergenic
1154348618 18:13564899-13564921 TTTCTTTTCTTTGGGGAGGCAGG - Intronic
1154997154 18:21651672-21651694 TTGGTTTTCTGGAGGGAATCTGG - Exonic
1155029456 18:21971611-21971633 TTGGTTTGTTTTTGGGAGACAGG - Intergenic
1159245229 18:65797173-65797195 TTGGTTTTCCTAGGAGAGACTGG - Intronic
1160214701 18:76918428-76918450 TTGGGGTTCTTTTGAGAAACAGG + Intronic
1160355251 18:78222209-78222231 TTGCTTGCCTTTGGGCAAACAGG + Intergenic
1161497154 19:4592923-4592945 TTGAGTTTCTTGGGGAAAACTGG + Intergenic
1162382768 19:10341190-10341212 TTTTTTTTTTTTGTGGAAACAGG - Intergenic
1162617651 19:11814758-11814780 CTGGTTTTCTTTGCGGCACCGGG - Intronic
1164334598 19:24301295-24301317 TTTCTTTTCTTTGGGGAATCTGG + Intergenic
1165202510 19:34156662-34156684 TTTGTATTTTTTGTGGAAACAGG - Intergenic
1165571226 19:36776393-36776415 TTGGTTTTATTTTTGGAGACAGG + Exonic
1165593337 19:36989724-36989746 TTGGATTTTTTTGTAGAAACGGG + Intronic
1165691945 19:37870449-37870471 TTGGTTTGATTTGGGAAGACTGG + Intergenic
1167532520 19:50026875-50026897 TTGGTTTTGGTTGGGGAAGGAGG + Intronic
1168059308 19:53882442-53882464 CTGCCTTTCTTGGGGGAAACAGG - Exonic
1168483383 19:56740251-56740273 GTGGTAGGCTTTGGGGAAACTGG - Intergenic
925299984 2:2804889-2804911 TTTTTTATCTTGGGGGAAACAGG - Intergenic
926193337 2:10744337-10744359 TTGGCAGTCCTTGGGGAAACAGG - Intronic
926565003 2:14459305-14459327 TTCTTTTTCTTTGGGGGAAATGG - Intergenic
926631193 2:15137781-15137803 TTGTTTTTGTTTTGAGAAACAGG + Intergenic
927190365 2:20513034-20513056 ATAGTGTTGTTTGGGGAAACGGG - Intergenic
927617571 2:24614399-24614421 TTTGTTTTGTTTGGAGAGACAGG + Intronic
927655206 2:24939417-24939439 TTTGTGTTTTTTGTGGAAACAGG + Intergenic
928268434 2:29832451-29832473 TTTGTTATCTTTGGGGGAAGAGG + Intronic
928421789 2:31142814-31142836 TTACTTTTCTTTAGGCAAACTGG - Intronic
929315115 2:40467717-40467739 ATTGTTTTCTTTGGGAAAAGAGG - Intronic
929505211 2:42522979-42523001 TTTTTTTTCTTTGTAGAAACAGG + Intronic
929874259 2:45783404-45783426 TTGGTTTTCTTTCTAGGAACAGG + Intronic
931431322 2:62211182-62211204 TTGGTATTTTTTGTGGAGACAGG - Intronic
931579359 2:63756676-63756698 TTGTTTTTATATGAGGAAACTGG - Intronic
931745571 2:65289019-65289041 TTTGTTTTTTTTGTGGAAATGGG + Intergenic
931754064 2:65356588-65356610 TAGGTTTTCTTTGGGGTAGAGGG - Intronic
932216165 2:69967354-69967376 TTGTTTTTCTCTGGTGATACTGG - Intergenic
933030307 2:77320021-77320043 TTGTTTTTTTTAGGGGAAACCGG + Intronic
934510275 2:94933415-94933437 TTCGTTTTCTATGTGGAAAATGG - Intergenic
936713053 2:115155078-115155100 TTGGTATTCTTAGTGGAGACGGG + Intronic
937479017 2:122240247-122240269 TTTGTTTTCTTTGGGGAAAGGGG - Intergenic
938775919 2:134541212-134541234 TTGCATTTCTTTTGGGAAATGGG - Intronic
938901738 2:135804261-135804283 TTCTTTTTCTTTTGGGAAAAGGG + Intronic
939200627 2:139030337-139030359 TTGATTTTCTTGGTGGAAAAGGG + Intergenic
939224843 2:139352139-139352161 ATTGTTTTCATTGGGGAAATTGG + Intergenic
939274086 2:139977652-139977674 GTGGTTATCTCTGGGGAAGCAGG + Intergenic
939365045 2:141219854-141219876 TTGTTTTTCTTTTGGCAATCAGG - Intronic
939987938 2:148850478-148850500 GTGGTTTTCTTTGGGGCATTTGG + Intergenic
940200845 2:151148720-151148742 GTGGAGTTCTTTGGGGAAGCTGG - Intergenic
941082460 2:161077850-161077872 TGGGGTTTATTTGGGGACACAGG + Intergenic
942134890 2:172915337-172915359 GTGGTTTTATTTTGGGAAAAAGG + Intronic
942419637 2:175794809-175794831 ATGGCTTGCTTTGGGGAAAAGGG + Intergenic
942871316 2:180737427-180737449 TTTGTTTTCTATGGGTAAAATGG - Intergenic
943179780 2:184527795-184527817 TGGGTTCTCTTTGTGCAAACTGG - Intergenic
944404888 2:199372952-199372974 TTTGTTTTATTTTGGGAAAAGGG - Intronic
945252957 2:207779705-207779727 TTTGTTTTCTTTGTAGAGACGGG + Intergenic
946524986 2:220508687-220508709 TTTGTTGACTTGGGGGAAACTGG - Intergenic
946536109 2:220630641-220630663 TTCACTTTCTTTTGGGAAACTGG - Intergenic
948093125 2:235312453-235312475 TTGGCTTTTTTGGGGGAAAGAGG + Intergenic
948288458 2:236806104-236806126 TTGTTCTTGTTTAGGGAAACAGG - Intergenic
948773538 2:240266728-240266750 TAGGATTGCTTTGGGGAATCGGG + Intergenic
1168894086 20:1312071-1312093 TTAGTTTTTTTTGTGGAAAGAGG + Intronic
1169184068 20:3597759-3597781 TTGATTTTCTTTGAGGAACCTGG + Intronic
1171430508 20:25081022-25081044 CTGGATTTCTTTGGGGAAATGGG + Intronic
1172280827 20:33706902-33706924 TTTTTTTTCTTTGGTGAGACAGG + Exonic
1172555454 20:35836996-35837018 TTGGTATTTTTTGTAGAAACGGG - Intronic
1172593896 20:36136349-36136371 TTTTTTTTTTTTGGAGAAACAGG + Intronic
1173076028 20:39820516-39820538 TTTTTTTTTTTTGGAGAAACAGG - Intergenic
1173304509 20:41835500-41835522 TAGGTTGTCTTTGGCTAAACTGG + Intergenic
1173428619 20:42965805-42965827 TTAATTTTCTTTGGGGACAGTGG + Intronic
1173430885 20:42986330-42986352 CTGGTTTGCTTTGGAGACACTGG - Intronic
1173698050 20:45038850-45038872 TTGTTTTTGTTTTGGGAAAATGG - Intronic
1173756480 20:45521169-45521191 TTGGTTCTCTTTGTGAAAGCAGG + Intergenic
1176957776 21:15126213-15126235 TAGGTTTTCTTTGGGGCTCCAGG + Intergenic
1177553038 21:22650807-22650829 TTGGATGTCTTTGGGGGAAGGGG + Intergenic
1178875780 21:36413005-36413027 TTGGTTTTCTTTGCTGTATCAGG - Exonic
1179233812 21:39527937-39527959 TTGGGATTCTTTGGGGAAACTGG - Intergenic
1179320678 21:40288157-40288179 TTGGTTTTCTGGGCGGAAAGGGG - Intronic
1179556065 21:42177019-42177041 TTGGTTTCTTTTTGGAAAACAGG + Intergenic
1180175167 21:46083776-46083798 TTGCGTTTCTTTGGGGGCACTGG - Intergenic
1182063388 22:27413693-27413715 CTGGTTTTCTATGGGCTAACGGG + Intergenic
1182297964 22:29320975-29320997 TTGCATTTCTTTGTAGAAACAGG + Intergenic
1183388889 22:37532269-37532291 TTGGTTTTGTTTTTGGAGACAGG + Intergenic
1184282286 22:43444532-43444554 TTTGTATTTTTTGTGGAAACGGG + Intronic
950398186 3:12750144-12750166 TTTTTTTTTTTTGTGGAAACAGG + Intronic
950787944 3:15451252-15451274 TTTGATCTCTTTGGGGAATCTGG - Exonic
950830384 3:15869219-15869241 TTTGTCATCTTTGGAGAAACAGG - Intergenic
950880446 3:16318735-16318757 TTGGGTTTTTTGGGGGATACAGG - Intronic
950993986 3:17474365-17474387 TTGTTTTCCTTTGGGCAAAATGG + Intronic
952465027 3:33574718-33574740 TTAGGTTTCTTTGAGAAAACTGG - Intronic
952696525 3:36270727-36270749 TTGGTTTTCAGTGGGTAATCAGG - Intergenic
953164449 3:40452654-40452676 TTCTTTTTCTTTGGGGCTACAGG + Intergenic
953300015 3:41764557-41764579 TTTGTTTTCTTTGTAGAGACAGG - Intronic
953974966 3:47375524-47375546 TGGGTTTTCTTTGGACAAGCTGG - Intergenic
954242863 3:49307771-49307793 TTGTTTTGTTTTGTGGAAACGGG - Intronic
955141878 3:56277779-56277801 CTAATTTTCTTTAGGGAAACTGG + Intronic
955378720 3:58419618-58419640 ATGGCTTGCTTTGGGGAAAAGGG + Intronic
957079190 3:75622622-75622644 TTGGCTATCTTTGGGAAAAACGG + Intergenic
957255299 3:77828154-77828176 CTGCTTTTCTTTGGGGGATCTGG - Intergenic
957320966 3:78629632-78629654 TTGGTTTTGTTTTTAGAAACAGG - Intronic
958503320 3:94942428-94942450 TTGGCATTCTTTGCAGAAACAGG - Intergenic
958844403 3:99248778-99248800 CTGGTTTTCTTTAGGGAGAGAGG + Intergenic
958912767 3:100013046-100013068 TTTGTTTTGTTTGGAGAGACAGG + Intronic
959021072 3:101187877-101187899 TTTGTATTCTTTGTGGAGACAGG + Intergenic
959068923 3:101684766-101684788 TTTTTTTTTTTTGGGGAGACAGG - Intronic
959849086 3:111067382-111067404 TTGGTTTTTTTTGGGGGACAGGG + Intergenic
960549945 3:118964167-118964189 TTGGATTACCTTGGGGAAACTGG + Intronic
960870651 3:122246544-122246566 CTGGTTTTCTTTGGAAAACCTGG - Intronic
961642947 3:128376244-128376266 CTGGTTTTCCTTGGGGATGCAGG - Intronic
962957845 3:140282677-140282699 TTGGTTTTCTTGGTGTACACAGG - Intronic
962976295 3:140448956-140448978 TTGCTCTTCTTTGGTAAAACGGG + Intronic
965452693 3:168857918-168857940 TTGTTTTTTTGTGGGGAAAAGGG + Intergenic
966169581 3:177063706-177063728 TTTGTTTTCTTTGTTTAAACTGG - Intronic
969290443 4:6235659-6235681 TTGGTTTCCTTAGGTGAAAATGG + Intergenic
971431825 4:26576529-26576551 TTCATTTTGTTTGGGGAATCTGG + Intronic
971521248 4:27553618-27553640 TTACTTTTGTTTGGAGAAACTGG + Intergenic
971538259 4:27781869-27781891 TTTGTTTTGTTTTTGGAAACAGG + Intergenic
972453435 4:39228256-39228278 AAGGTGTTCTTTGGGAAAACTGG + Exonic
972526789 4:39921562-39921584 TAAGTTTTCTTTGTAGAAACAGG - Intronic
974293296 4:59962313-59962335 TTGGTATTTTTTGTGGAGACAGG - Intergenic
974295490 4:59993913-59993935 TTGGTTCTCTTCAGGAAAACTGG + Intergenic
975932018 4:79536507-79536529 TTGGTTTTTTTTTTGGAAAAAGG + Intergenic
976416276 4:84779782-84779804 TTGTTTTTCTCTGTGGAAATGGG - Intronic
977457162 4:97275960-97275982 TTGGTTTTTTTTGCAGATACGGG - Intronic
977560229 4:98525337-98525359 TGGGTTTTCTTTGGGTACTCTGG + Intronic
977942392 4:102873270-102873292 TTGGTTTTCTTTTGTGAGAAAGG + Intronic
978844996 4:113262824-113262846 TTGGTATTGGTGGGGGAAACAGG + Intronic
979135278 4:117103680-117103702 CTGGCTTGCTTTGGGGAAATGGG - Intergenic
979617819 4:122764037-122764059 GTGGTTATCTTTGGGGAAGAGGG + Intergenic
979783323 4:124683645-124683667 TTGGCAGTCTTTGGGGAAATGGG - Intronic
980299852 4:130975369-130975391 TTTTTTTTCTTTGGGGACACAGG + Intergenic
980796827 4:137696300-137696322 TTGGTTTATTTTAGGGAAAGGGG + Intergenic
981092392 4:140745090-140745112 TTGGTTTTGTCTGGGCAGACAGG - Intronic
981330046 4:143497862-143497884 TTGGTTTTTTTAGTGGAGACAGG - Intergenic
981377865 4:144036791-144036813 TGGGTTTGATTTGGGAAAACTGG - Intergenic
981732322 4:147912659-147912681 TTTTTTTTTTTTGGGGAGACAGG + Intronic
982005404 4:151058441-151058463 TTGGTATTTTTTGTAGAAACGGG - Intergenic
982013030 4:151125287-151125309 TTGGTATTCTTTGTAGAGACTGG - Intronic
983185414 4:164695082-164695104 TTTGTATTTTTTGTGGAAACGGG - Intergenic
983480622 4:168269423-168269445 TTTGTTTTCTTAGTGGAGACGGG - Intronic
983587199 4:169368656-169368678 TTTCTTTTTTTTGGGGAATCAGG - Intergenic
983845035 4:172507293-172507315 GTGGTTGGCTTTGGGGAAATAGG + Intronic
983870146 4:172816144-172816166 ATGGTTTTCTGTGGGAAGACAGG + Intronic
984287893 4:177756988-177757010 TTAGTTTTCTGTGAGGAAGCAGG - Intronic
984612623 4:181857749-181857771 TTTTTTTTGTTTGGGGGAACAGG - Intergenic
985825666 5:2189041-2189063 TTGCTTTCCTTGGGGGAAGCTGG + Intergenic
986185472 5:5432151-5432173 TAGGGTTTCTTTGGGGAAGGTGG - Intronic
986674925 5:10175703-10175725 TTAGTTTTCTTAGGAAAAACTGG - Intergenic
986701011 5:10408708-10408730 TTTGTATTTTTTGGGGAGACCGG + Intronic
987557058 5:19466126-19466148 TTGGTTATCTTTTGTGAGACAGG + Intergenic
987598777 5:20038022-20038044 TTGTTTTTCTGTGGGGTAAGTGG - Intronic
987715629 5:21565985-21566007 TTGGTTTTCCTTTGGGATTCAGG + Intergenic
987910908 5:24144071-24144093 TTGTTTTTCTTTGGTAAAACAGG + Intronic
988214387 5:28252283-28252305 TTCGTTTTCATGGGGGAAAAGGG - Intergenic
988450457 5:31337342-31337364 TTGGTGTTCTGTGGAGAAGCAGG + Intergenic
988582239 5:32478299-32478321 TTGTATTTCTTTGTAGAAACAGG - Intergenic
988664255 5:33307948-33307970 GTGGTTTTCTTTGGGTAGAGAGG - Intergenic
988807874 5:34757272-34757294 TATGTTTTCTTTTGGGAAAGCGG + Intronic
988824245 5:34918350-34918372 TTCTTTTTCTTTAGGGAAAGTGG + Exonic
988828480 5:34964873-34964895 TTTCTTTTCTTTGTTGAAACAGG + Intergenic
989050952 5:37319862-37319884 TTGGTTTTCTTTTTTGAGACTGG - Intronic
989291189 5:39768124-39768146 TGGGTTTTCTCTGGGGAGTCCGG - Intergenic
989331821 5:40268700-40268722 TTTTTTTTTTTTGGAGAAACAGG - Intergenic
989455175 5:41635578-41635600 TTGCATATCTTGGGGGAAACTGG - Intergenic
990375619 5:55167687-55167709 TTGATTTTTTTTGTGGAGACAGG - Intronic
990956099 5:61341116-61341138 TGGGTTTTCTTTGGGTACTCTGG + Intronic
992211678 5:74485945-74485967 TTGGTTATTTTTGGTAAAACTGG + Intergenic
992569180 5:78036608-78036630 CTGGGTCTCTTTGGGGAAAATGG + Intronic
993204145 5:84858898-84858920 TTTATTTTCATTGGGAAAACTGG + Intergenic
993378976 5:87183826-87183848 GTTGTTTTCTTTGGGGCAGCTGG - Intergenic
993589115 5:89771873-89771895 TTGATTGTCTTTGAGGAGACTGG - Intergenic
994376490 5:99020733-99020755 TTGTTTTTCTTTATAGAAACAGG - Intergenic
994821077 5:104652145-104652167 TTGGTTTTCTTTGTGGAAGTAGG - Intergenic
994925996 5:106118031-106118053 TGGTTTTTCTGTGGGGAAAGGGG + Intergenic
994970778 5:106733922-106733944 TTGTGTTTCTTTGGGGTCACTGG - Intergenic
995632628 5:114150469-114150491 TTGATTTTCTTTGGTTAAAGAGG - Intergenic
997250667 5:132386401-132386423 TTGTATTTCTTTGGAGAGACGGG + Intronic
997420277 5:133761507-133761529 TGGGTTTTCTCAGGGGAAATGGG - Intergenic
999830790 5:155317355-155317377 TTGGTGCACTTTGGGGAGACTGG + Intergenic
1002024451 5:176387628-176387650 TTGCTTTTCTTTTGGGAACCTGG + Intronic
1002268619 5:178054326-178054348 TTCTTTTTCTTTTGTGAAACAGG - Intronic
1002568107 5:180124959-180124981 TTGGTATTTTTTGTGGAGACAGG - Intronic
1002793487 6:451917-451939 TTGATTTGCTTTTGGCAAACAGG + Intergenic
1003214891 6:4100094-4100116 TTGGTATTTTTAGTGGAAACGGG + Intronic
1003301490 6:4887219-4887241 GTTGTTTTCTTTGTAGAAACTGG - Intronic
1003677081 6:8215161-8215183 TTTGTTCTCTTTGGGTACACAGG - Intergenic
1004291007 6:14367289-14367311 TTTGTTTTCTTTGAGGGAAGAGG - Intergenic
1005477254 6:26219859-26219881 GTGGTTGGCTTTGGGGAAAAAGG - Intergenic
1005966191 6:30728281-30728303 ATGTCTTTGTTTGGGGAAACAGG - Intronic
1006138598 6:31913020-31913042 TTTTTTTTTTTTGTGGAAACAGG - Intronic
1006288007 6:33112854-33112876 TTGCTTGTCTATGGGGAAATGGG + Intergenic
1006487094 6:34352021-34352043 TTTGTTTTTTTTGTGGAGACAGG - Intronic
1007154932 6:39733348-39733370 TTTGTTTTCTTGGGTGAAACAGG - Intergenic
1008102193 6:47403981-47404003 TTGTTTTTCTTGGATGAAACAGG - Intergenic
1008203430 6:48621993-48622015 TTGCTATTCTGTGGGGAAAAAGG - Intergenic
1009001096 6:57716065-57716087 TTGGTTTTCCTTTGGGATTCAGG - Intergenic
1009239086 6:61162757-61162779 TTGGTTTTCCTTCAAGAAACAGG + Intergenic
1009294956 6:61934885-61934907 TGGGATTTCTTTAGGGAAACTGG + Intronic
1009775116 6:68195689-68195711 TTGGTGTTTTGTGGGAAAACTGG - Intergenic
1009874862 6:69493427-69493449 TTGGTTTTCTGTGGGGAGTGGGG - Intergenic
1010506912 6:76671793-76671815 TTGGTATTCGTGGGGGATACTGG + Intergenic
1010804671 6:80221069-80221091 TGGGTTTTATTTGGGGGAAGTGG + Intronic
1011346781 6:86379012-86379034 TTGGTTTTCTTTGTGGGTAGGGG - Intergenic
1011968394 6:93189723-93189745 TTTGTTTTCTGTTGGGAAAGTGG - Intergenic
1012191140 6:96281587-96281609 ATGGTTTGCTTTGGGGCAAATGG - Intergenic
1012635580 6:101535484-101535506 TTGGCTTTGTTTGGGAAATCGGG + Intronic
1012672736 6:102076022-102076044 TAGGTTTCCCTTAGGGAAACAGG - Intergenic
1012965309 6:105667503-105667525 TTGGTTTTCTTTGCTGTATCAGG - Intergenic
1013824045 6:114189955-114189977 TCAGTTTTCTTTGGGGAATTTGG - Intronic
1013939071 6:115638895-115638917 TTGTTTTTCTATAGGGAAAAGGG - Intergenic
1014723114 6:124942700-124942722 TTTGTTTTCCTTGGGTAAATAGG + Intergenic
1014880778 6:126721810-126721832 TTGATTTGCTTTGCTGAAACTGG + Intergenic
1015039439 6:128699093-128699115 TTTTTTTTCTTTAGGGACACAGG - Intergenic
1015216795 6:130759624-130759646 TTGGTTTTCTGTTGGGAGAGTGG - Intergenic
1015734522 6:136384497-136384519 TTTTTTTTTTTTGGGGAGACAGG + Intronic
1015807021 6:137119966-137119988 GTGGTTTTCTTGCGGGAATCAGG - Intergenic
1016615369 6:146041780-146041802 TTGGTTTTCTGTGAGGAAGATGG + Intronic
1017095129 6:150797945-150797967 TTGTTTTTTTTAGGGGAAACTGG - Intronic
1017128272 6:151086168-151086190 TGGGATTTCTTTGGGGTAGCTGG - Intronic
1017276743 6:152578421-152578443 TTTGTATTTTTTGTGGAAACGGG - Intronic
1017380756 6:153826366-153826388 TTTGTTTTTTTTGTGGAGACAGG - Intergenic
1017472620 6:154754396-154754418 TTTGTTTTGTTTTTGGAAACTGG + Intronic
1017995568 6:159529105-159529127 GTGATTTCCTTTGGGGAAAAGGG + Intergenic
1018992597 6:168685430-168685452 TTAGTATTCTCTGGAGAAACAGG + Intergenic
1020174922 7:5874508-5874530 TTTTTTTTCTTTGGAGAGACAGG + Intergenic
1020230129 7:6312072-6312094 TTGTTTTTTTTTGGAGAGACAGG - Intergenic
1021636165 7:22696052-22696074 TTTGTATTTTTTGTGGAAACAGG + Intergenic
1022217116 7:28274195-28274217 TTGGTTTTTTTTGTTGAGACAGG - Intergenic
1022394237 7:29971459-29971481 TTTGTATTTTTTGTGGAAACAGG - Intronic
1023721876 7:43104248-43104270 TTGTTTTTCTCAGGGGAAAGAGG - Intergenic
1024310157 7:47961762-47961784 TTTTTTTTCTTGGGGGAGACAGG - Intronic
1024395292 7:48859397-48859419 TTTGGTTGCTTAGGGGAAACTGG - Intergenic
1024399944 7:48912889-48912911 TTTGGTTGCTTAGGGGAAACTGG + Intergenic
1024793903 7:53000255-53000277 TTTTTTTTCTTTTGGGAAATTGG - Intergenic
1024871751 7:53971531-53971553 TTTGTTCTCTTTGTGGAGACTGG - Intergenic
1024981624 7:55161761-55161783 TGGGTTTTCTGTGGGGAGACGGG + Intronic
1025047171 7:55701584-55701606 TTGCTTTTCTATTGGGGAACAGG - Intergenic
1025124289 7:56332309-56332331 TAGGTTTTCCCTGGAGAAACAGG + Intergenic
1025963479 7:66246014-66246036 TTGGTTTTTTTTTTGGAGACAGG + Intronic
1026486010 7:70822004-70822026 TTTGTATTTTTTGGGGAGACAGG - Intergenic
1026860278 7:73782325-73782347 TTTGTGTTTTTTGGGGGAACTGG + Intergenic
1028028274 7:85874949-85874971 ATGGTTTTCTTGGGGGAAAATGG + Intergenic
1028277850 7:88879865-88879887 TTTGTATTTTTTGGAGAAACGGG - Intronic
1028649251 7:93132306-93132328 TTCATTTTCTTTGTGGAAAAAGG + Exonic
1028912245 7:96221798-96221820 TTGGTGTGCTTTGGGAAAATGGG - Intronic
1029083856 7:97996136-97996158 TTTTTTTTCTTTGGAGAGACAGG - Intergenic
1029821418 7:103150884-103150906 TTTTTTTTTTTTGGGGAAATGGG - Intergenic
1029959407 7:104673606-104673628 TTGTTTCTCTTTGGGCAAATAGG + Intronic
1030396743 7:108995500-108995522 ATGGCTTTCTTTGGGGAAGAAGG + Intergenic
1031048846 7:116924609-116924631 TTAGTATTCTTTTGGGAAACAGG - Intergenic
1031414999 7:121485250-121485272 TTGGTTATCAGTGGGGACACAGG + Intergenic
1031455272 7:121971453-121971475 TTGTTTTTCTTAGGGGAGAGTGG + Intronic
1031649463 7:124269057-124269079 TCAATTTACTTTGGGGAAACTGG + Intergenic
1031926832 7:127646771-127646793 TAAGTTTCCTTTGGGAAAACAGG - Intergenic
1032400724 7:131622585-131622607 TTCATTTTCTTTGTGGAGACAGG - Intergenic
1033044620 7:137950390-137950412 TTGTCTTTTTCTGGGGAAACTGG + Intronic
1033061098 7:138108446-138108468 TTGGTAATATTTGGGGAAACAGG + Intronic
1033163835 7:139020982-139021004 TTTTTTTTTTTTGGGGAGACAGG - Intergenic
1033165699 7:139036637-139036659 TTGTTTTGCTTTGTAGAAACGGG + Intergenic
1033261659 7:139849362-139849384 TGTGTTTTTTTTGGGGGAACAGG - Intronic
1033905379 7:146195228-146195250 TTGATTTTCTTTGGAAAAAACGG + Intronic
1033913740 7:146298091-146298113 TTGGTTTTCTTACAGAAAACAGG + Intronic
1034550406 7:151816858-151816880 TTGGTTTTCCTTGGAAAAGCTGG + Intronic
1034974517 7:155440045-155440067 AGGGTTTTCTTTGGGGAGAGAGG - Intergenic
1035069479 7:156131296-156131318 TTGGGTTTCTAAGGGGTAACAGG - Intergenic
1036694479 8:10965591-10965613 TTGGTTTTCTGTCTGGAAAGAGG - Intronic
1037413597 8:18623438-18623460 TTTTTTTTTTTTGGGGAGACGGG - Intronic
1037767886 8:21782999-21783021 TTGGTGTGCTTTGGCGAAATGGG - Intronic
1038321576 8:26531944-26531966 TTGGTGTCCTTTGGGAAGACAGG + Intronic
1038562597 8:28593522-28593544 TTGTTTTTGTGTGGGTAAACTGG + Intergenic
1039040469 8:33403196-33403218 TTGCTTTTCTTTGGGAATACGGG - Intronic
1039458152 8:37721654-37721676 TTGGATTTTTTTGTAGAAACTGG + Intergenic
1039594323 8:38777608-38777630 TTTGTTTTGTTTGTAGAAACAGG - Intronic
1039891896 8:41691218-41691240 TTGGTTTTATTTTTAGAAACAGG - Intronic
1040067547 8:43160091-43160113 TTTGTTTTCTTTGGGAAGGCAGG - Intronic
1040474228 8:47762888-47762910 TCGGTTTCATTTGGGGTAACAGG + Intergenic
1041195121 8:55394134-55394156 TTGGTTTTCTTTTGAGAATTAGG - Intronic
1041565354 8:59271362-59271384 TTATTATTCATTGGGGAAACTGG - Intergenic
1042258449 8:66831350-66831372 TTGGTTTTTTTTTTGGAGACAGG + Intronic
1042263954 8:66889623-66889645 TTTGTTTTTTTTGGAGAGACGGG - Intronic
1042519907 8:69700429-69700451 TTGTTCTTGTTTGGGGATACTGG - Intronic
1043000735 8:74756677-74756699 TTGGTTTTCTTTAAGGTATCTGG - Exonic
1043660184 8:82729514-82729536 TAGCTTTTCTTTTGGGAAATTGG - Intergenic
1043728042 8:83637166-83637188 TCAGTTTTCTTTGGGAAATCAGG - Intergenic
1043944256 8:86231816-86231838 TTGCTTTGGTTTGGGAAAACTGG + Intronic
1044984194 8:97743593-97743615 TTTGTATTCTTTGTGGAGACGGG - Intergenic
1045276019 8:100706457-100706479 CTAGTTTTCTTTGTGGAGACAGG + Intronic
1045663868 8:104466194-104466216 TTGGTTTTGGTTGGGGATAAAGG + Intronic
1045807782 8:106185338-106185360 TTTGTATTCTTTGTGGAGACAGG - Intergenic
1045986347 8:108253921-108253943 TTTGTTTTGTTTTGGGAGACAGG + Intronic
1046154697 8:110272719-110272741 TTACTTTTCTTTGTGGAAAGTGG + Intergenic
1046542843 8:115609016-115609038 TTTGTATTTTTTGTGGAAACAGG + Intronic
1047420541 8:124704546-124704568 TTGGTGTTGTTTGGGGCAAGTGG - Intronic
1048062585 8:130935785-130935807 TTTGTTTCCTTTGTGAAAACTGG + Intronic
1048592126 8:135830138-135830160 ATGGTTTTCTTTATGGGAACAGG + Intergenic
1048756320 8:137742052-137742074 TTGATGTTCATTGGGGATACTGG + Intergenic
1048867277 8:138770243-138770265 ATGGTTTTCTAGGTGGAAACAGG + Intronic
1048888065 8:138924547-138924569 CTGGTTTTCTTTAGGGAACAGGG + Intergenic
1050832434 9:10030280-10030302 TAGGTTTCTTTTGGGGAAACTGG + Intronic
1051484397 9:17592721-17592743 TTTTTTTTCTGTGAGGAAACAGG - Intronic
1053785916 9:41652868-41652890 TTTGTTTTCTTGGGGGAGATGGG - Intergenic
1054174630 9:61866801-61866823 TTTGTTTTCTTGGGGGAGATGGG - Intergenic
1054449489 9:65395861-65395883 TTTGTTTTCTTGGGGGAGATGGG - Intergenic
1054662908 9:67713992-67714014 TTTGTTTTCTTGGGGGAGATGGG + Intergenic
1055048707 9:71958128-71958150 CTGGTGTTGTTTGGGGAAATAGG + Intronic
1055483999 9:76739137-76739159 TTGGTGTTCTTTGTGGAAAATGG - Intronic
1055914644 9:81388713-81388735 TTGCTTCACTTTTGGGAAACAGG - Intergenic
1057280075 9:93702618-93702640 GTGGTTTTCTTCTGGGAAGCTGG + Intergenic
1059019913 9:110565145-110565167 TTTGTTTTCTTTTGTGAAATGGG + Intronic
1059052408 9:110940441-110940463 TTGAATTTCTGTGGGGAAAGAGG + Intronic
1059193326 9:112347512-112347534 TTGTATTTTTTTGTGGAAACAGG + Intergenic
1059269358 9:113062274-113062296 TTAGTTTTCTATGGAGAAACAGG + Intergenic
1059270493 9:113067721-113067743 TTAGTTTTCTATGGAGAAACAGG + Intergenic
1059271630 9:113073171-113073193 TTAGTTTTCTATGGAGAAACAGG + Intergenic
1059272761 9:113078615-113078637 TTAGTTTTCTATGGAGAAACAGG + Intergenic
1059273895 9:113084057-113084079 TTAGTTTTCTATGGAGAAACAGG + Intergenic
1059275028 9:113089501-113089523 TTAGTTTTCTATGGAGAAACAGG + Intergenic
1059971894 9:119676896-119676918 TTTTTTTTCTTTTTGGAAACAGG + Intergenic
1061175905 9:128996767-128996789 TAGGTTTCCTTTGGGGAAAGAGG - Intronic
1061334005 9:129917354-129917376 TTGGTTTTGTTTTTGGAGACAGG + Intronic
1062144174 9:134979655-134979677 GTGGTTTTCTCTGTGGAAACAGG + Intergenic
1062380863 9:136285972-136285994 TTGGTTTCCTTTCTGGAAAGGGG - Intronic
1062699927 9:137893771-137893793 GAGGTTTCCTTTGGGGGAACTGG - Intronic
1062735307 9:138134243-138134265 TTGGTTTTCTTTTTGGAGACAGG + Intergenic
1203406627 Un_KI270538v1:25610-25632 TTGGATAGCTTTGAGGAAACGGG + Intergenic
1185527214 X:789338-789360 TCGGCTTGCCTTGGGGAAACAGG - Intergenic
1186292334 X:8113908-8113930 TTAGGTTCCTTTGGGGAAAACGG + Intergenic
1187288321 X:17927677-17927699 TTTTTTTTTTTTGTGGAAACAGG - Intergenic
1187920485 X:24196598-24196620 TTTTTTTTCTTTTGGGAGACAGG + Intronic
1189032857 X:37467626-37467648 TTGGGTTCCTGTGGGGATACAGG - Intronic
1189287633 X:39863075-39863097 TTGTTTTACTTTGGGGTAACGGG - Intergenic
1189304445 X:39976029-39976051 TTTGTTTTGTTTGTAGAAACAGG + Intergenic
1190034482 X:47008753-47008775 TTGGTTTTCTGGGAGGAGACAGG + Intronic
1190071015 X:47279396-47279418 TTGGTTTTTTTTGTAGAGACAGG - Intergenic
1190442153 X:50485471-50485493 TTGTTTTGCTCTGGGGAAGCAGG + Intergenic
1190455872 X:50627513-50627535 TTAGTTTCCTTTGAGGAAACTGG - Intronic
1190550497 X:51575017-51575039 TTGGTGTCCTTGGGGGAAAAAGG - Intergenic
1190912841 X:54788375-54788397 TTGCTTATCTCTAGGGAAACTGG + Intronic
1192135717 X:68597935-68597957 TTGTGTTTCTTTGGAGAACCTGG + Intergenic
1192594278 X:72389788-72389810 TTGGCTTTCTTTAGGGAGACAGG + Intronic
1192937140 X:75871830-75871852 TTTGTTTTCTTTGGGGAGGTGGG + Intergenic
1193380903 X:80814784-80814806 TTGTTTTTCTTTGCAGAGACAGG - Intergenic
1195051709 X:101102998-101103020 TTTTTTTTCTTTTGGGAGACTGG + Intronic
1195227671 X:102815042-102815064 TTGTTCTAGTTTGGGGAAACTGG + Intergenic
1195576990 X:106462391-106462413 TGGATTTTTTTTGGGGAAAGGGG + Intergenic
1197031836 X:121825726-121825748 TTGGATTTCTTTGGCTAATCAGG - Intergenic
1197579055 X:128259212-128259234 TTGGTTCGTTTTGGGGATACAGG - Intergenic
1197837937 X:130715023-130715045 TTGTTCTTGTTTGGGGAAATGGG + Intronic
1198147926 X:133876728-133876750 TTGTTTTTGTTTGGGGACATGGG + Intronic
1198476032 X:136999203-136999225 TTGCTTTCCTTTGGGGAGTCCGG - Intergenic
1198745599 X:139887451-139887473 GTGGTTTTTTTTGTAGAAACAGG - Intronic
1198808793 X:140514153-140514175 TTGGTTTTCTTTTTGGAAAGAGG + Intergenic
1199136081 X:144254785-144254807 TTGGTTTTCTTTGTGGAGGTGGG - Intergenic
1199459614 X:148070016-148070038 TTGGTTTTCTGTCGGGGAAGGGG + Intergenic
1200178277 X:154133928-154133950 TTTCTTTTTTTTGGGGAGACAGG + Intergenic
1200611973 Y:5335442-5335464 TTTGTTTTCTTAGAGGAACCAGG + Intronic
1201366821 Y:13216133-13216155 TTGGTTTTCTTTGGGGGATGGGG - Intergenic
1201907311 Y:19098989-19099011 TTGGTTAATTTTTGGGAAACCGG - Intergenic