ID: 1129752768

View in Genome Browser
Species Human (GRCh38)
Location 15:78077516-78077538
Sequence GGCTATCTGCAGAAGCTGTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 357}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129752768_1129752779 24 Left 1129752768 15:78077516-78077538 CCCGACAGCTTCTGCAGATAGCC 0: 1
1: 0
2: 1
3: 21
4: 357
Right 1129752779 15:78077563-78077585 CGGACCCGCCCCGGGCTCCGCGG 0: 1
1: 0
2: 1
3: 30
4: 189
1129752768_1129752774 15 Left 1129752768 15:78077516-78077538 CCCGACAGCTTCTGCAGATAGCC 0: 1
1: 0
2: 1
3: 21
4: 357
Right 1129752774 15:78077554-78077576 CTCCCGCGCCGGACCCGCCCCGG 0: 1
1: 0
2: 1
3: 20
4: 211
1129752768_1129752770 -8 Left 1129752768 15:78077516-78077538 CCCGACAGCTTCTGCAGATAGCC 0: 1
1: 0
2: 1
3: 21
4: 357
Right 1129752770 15:78077531-78077553 AGATAGCCACACAGCCGCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 54
1129752768_1129752772 4 Left 1129752768 15:78077516-78077538 CCCGACAGCTTCTGCAGATAGCC 0: 1
1: 0
2: 1
3: 21
4: 357
Right 1129752772 15:78077543-78077565 AGCCGCGCTGGCTCCCGCGCCGG 0: 1
1: 0
2: 1
3: 10
4: 157
1129752768_1129752775 16 Left 1129752768 15:78077516-78077538 CCCGACAGCTTCTGCAGATAGCC 0: 1
1: 0
2: 1
3: 21
4: 357
Right 1129752775 15:78077555-78077577 TCCCGCGCCGGACCCGCCCCGGG 0: 1
1: 0
2: 2
3: 38
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129752768 Original CRISPR GGCTATCTGCAGAAGCTGTC GGG (reversed) Exonic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905029652 1:34873309-34873331 GGTTATCTGCTGGAGATGTCTGG + Intronic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905426608 1:37890544-37890566 GAATATCTCCAGAATCTGTCTGG - Intronic
906217675 1:44053320-44053342 GGCTAGCTGTAGAACATGTCTGG + Intergenic
906569297 1:46822591-46822613 GGCTTGCTGCAGCAGCTGTGGGG + Intergenic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910561899 1:88599979-88600001 GGTTATCTGCAGAAGATGGCAGG - Intergenic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912209799 1:107545378-107545400 CGCTATCAGAAGAGGCTGTCAGG - Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
915367007 1:155322242-155322264 GGAGAGCAGCAGAAGCTGTCCGG - Exonic
915874727 1:159600543-159600565 GGCTTCCTACAGAAGCTGTTGGG + Intergenic
915894241 1:159799049-159799071 TGCTCTCTCCAGAAGCTTTCTGG + Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918870818 1:189971767-189971789 ACGTATCTTCAGAAGCTGTCTGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
919707763 1:200694879-200694901 GGCAAACTGCAAGAGCTGTCTGG - Intergenic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065043373 10:21720291-21720313 GGCTGACTGTTGAAGCTGTCAGG - Intronic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG + Intronic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073656681 10:105424485-105424507 AGTTATCTGCAGAAGATGTCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1075732090 10:124642482-124642504 TCCCATCTGCAGAAGCTGCCCGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1077363022 11:2149203-2149225 GGCTCTCTGCCGAAACTGCCTGG + Exonic
1077707618 11:4503272-4503294 GGATGTCTGCAGAAGCAGTGAGG + Intergenic
1077933119 11:6754017-6754039 GGCTACCTGTAGAACATGTCTGG - Intergenic
1077997549 11:7466977-7466999 GGCCACCTGCAGAAGGTGGCTGG - Exonic
1078653808 11:13219858-13219880 GCCTATCTGCAATTGCTGTCTGG - Intergenic
1079509391 11:21193509-21193531 GGCTATGTGAAGATGCTGACTGG - Intronic
1079994559 11:27281971-27281993 AGCTCTCTGCAGAATGTGTCTGG - Intergenic
1080076590 11:28157493-28157515 AGTTATCTGCAGAAGATGTCAGG - Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092199346 12:6570442-6570464 CGCCATCTGCAGGAGCTGGCGGG - Exonic
1092283670 12:7116118-7116140 GGCTTTATGCAGAAGCCATCAGG - Intergenic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093392086 12:18635562-18635584 GGTTATCTGCATAAGATGGCAGG + Intronic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096010956 12:48213923-48213945 GGGTTTCTGCAGAAGCAGTTGGG + Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1100083302 12:90878185-90878207 AGTTATCTGCAGAAGATGTCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101193834 12:102362424-102362446 GGCTAGCAGCTTAAGCTGTCAGG - Intergenic
1101229161 12:102722183-102722205 GGCCATCTGGATAACCTGTCAGG + Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101409092 12:104454510-104454532 GCCAATCTGCAGAATCTTTCAGG + Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108357142 13:49638326-49638348 GTCTATGTGGAGAACCTGTCTGG + Intergenic
1109156009 13:58910390-58910412 GGCTATGTTCAGAAGCTATATGG + Intergenic
1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111956085 13:94759863-94759885 GGCTTTGGGCAGAAGCTGTGGGG + Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1113319708 13:109221690-109221712 CGTTATCTGCAGAAGATGGCAGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114905378 14:27120449-27120471 TGCTATCTGAAGAAGATGGCAGG + Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1116158382 14:41236692-41236714 AGCTATCTGCAGAAGGTGACAGG + Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117102956 14:52369305-52369327 GACTTTCTGTTGAAGCTGTCGGG - Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119435429 14:74595096-74595118 TGCTCTCTGCAGACGCTGTCTGG + Intronic
1119937272 14:78603365-78603387 GGCTGCCTGCAGCAGCTGTGGGG + Intronic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1121310832 14:92934190-92934212 GCCCGTCTGCAGAAGCTTTCAGG - Intronic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1129752768 15:78077516-78077538 GGCTATCTGCAGAAGCTGTCGGG - Exonic
1129904633 15:79177832-79177854 GGCCATCTTCAGGAGCTCTCAGG + Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1136020947 16:27439753-27439775 GGCTAGCTGCAGATCCTGGCAGG - Intronic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138475254 16:57266804-57266826 GTTTATCTGCAGGACCTGTCTGG - Intronic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1142593545 17:1018533-1018555 AGCTTCCTGCAGAAGCTGCCAGG - Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146526996 17:33575616-33575638 TGCTATCTGCAAAAACTGTACGG + Intronic
1148611660 17:48968765-48968787 GGCTATCTCCAGCTGCTGTCTGG + Intergenic
1149379452 17:56078771-56078793 GGTTCTCTCCAGAAGCTGTGTGG + Intergenic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1152584430 17:81182679-81182701 GGCTCTCTGCAGAGACTCTCAGG - Intergenic
1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG + Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153918855 18:9770755-9770777 GGCTATCTTCAGAGCCTGTCAGG + Intronic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155266247 18:24097114-24097136 GACTCTCTGGTGAAGCTGTCCGG + Intronic
1155438171 18:25834268-25834290 GGAACTCTGCAGAAGCTGTTGGG + Intergenic
1155545670 18:26912052-26912074 GACCATCTGCAGTGGCTGTCAGG + Exonic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1157429663 18:47614257-47614279 AGCAATGTGCAGAAGCTGACTGG - Intergenic
1158325953 18:56314201-56314223 GGCTACCTGCAGAAGCAGATGGG - Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1160375145 18:78405938-78405960 GGGTATCGGCAGATCCTGTCCGG + Intergenic
1160527653 18:79546879-79546901 GCCTGTCTGCAGGAGCTGGCAGG - Intergenic
1160750156 19:730174-730196 GGCTTCCTGCAGGAGGTGTCTGG - Intronic
1163032537 19:14553858-14553880 GGCCAGCTGCAGGACCTGTCAGG + Intronic
1164911253 19:32013837-32013859 GGCCATGTGTGGAAGCTGTCAGG - Intergenic
1165522715 19:36327427-36327449 GGCTATCTCTAAAAGCTGACTGG + Intergenic
1166435621 19:42764632-42764654 GGGTATCTGAAGGAGGTGTCAGG - Intronic
1167300485 19:48674750-48674772 GGCCTTCTGTAGAAGCTGTGAGG - Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
925631532 2:5898829-5898851 GGCTGTGTGGAGAGGCTGTCTGG - Intergenic
925888481 2:8413602-8413624 TGCAATGTGCAGAAACTGTCAGG + Intergenic
926231673 2:11008944-11008966 GGCCATGTGCATAACCTGTCTGG - Intergenic
926276525 2:11407384-11407406 GGCTAACTGCAGAAGGTGAATGG + Intergenic
926575523 2:14576181-14576203 TGATATAAGCAGAAGCTGTCTGG - Intergenic
926820786 2:16849356-16849378 GGCTACTTGAAGAAGCTTTCTGG + Intergenic
926825569 2:16902261-16902283 GGTTATCTGCAGAAGATGGCAGG + Intergenic
929095320 2:38258155-38258177 GGCTATATGCACATGCAGTCAGG - Intergenic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
933949270 2:87314171-87314193 GGCTACCTGCAGAAGCCCACAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
936232523 2:110715769-110715791 ATCTCTCTCCAGAAGCTGTCTGG + Intergenic
936330926 2:111547426-111547448 GGCTACCTGCAGAAGCCCACAGG - Intergenic
937852573 2:126648767-126648789 AGCTATCTGCAGGAGATGACAGG + Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939656765 2:144835906-144835928 GGCTCTCAGCAGATGCTGTTGGG - Intergenic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941228878 2:162884023-162884045 GGCTATTTGCATATGGTGTCTGG + Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
945783367 2:214204152-214204174 GGCTTTCTGCAGCTGCTGTGGGG - Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
947529555 2:230900233-230900255 GGCTGTGTGCAGAAGCCCTCTGG - Intergenic
1169011924 20:2258168-2258190 GGCTTCCTGAAGAAGCTTTCAGG + Intergenic
1169575602 20:6956716-6956738 GACTCTCTGCAGAAGGTGTTTGG - Intergenic
1172832713 20:37849660-37849682 GATTTTCTGCAGAAACTGTCAGG - Intronic
1173000526 20:39102227-39102249 AGGGATCTGGAGAAGCTGTCAGG - Intergenic
1173568363 20:44058378-44058400 GGCTTGCTGCAGATGCTGTGGGG - Intronic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178136074 21:29629233-29629255 TGCTATTTGCAAAAGCTTTCTGG + Intronic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1181367439 22:22388973-22388995 AGCTACCTGCAGAAGATGGCAGG + Intergenic
1182137547 22:27919673-27919695 GGCTGCCTCCAGAACCTGTCAGG - Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
1184940628 22:47762149-47762171 TGCTACCTGCAGAGGCTGTGAGG - Intergenic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
950395967 3:12734382-12734404 GGCTATCTGCATGCGCTCTCAGG - Exonic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951655456 3:25002265-25002287 GTCTATCTCCTGAAGCTGACAGG - Intergenic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952999382 3:38918241-38918263 TGCTATATGCAGCAGCTGTCGGG + Intronic
953404302 3:42653045-42653067 GGATGTCTGCAGCAGCTGCCAGG + Intergenic
954145294 3:48631460-48631482 GGCTATGGGGAGATGCTGTCAGG + Intronic
955702379 3:61694790-61694812 GGCTATGTGCAGAATTTGTACGG + Intronic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
956767261 3:72494186-72494208 CGCTATCTGTAGAAACTGTGGGG - Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959921187 3:111870197-111870219 GGATGGCTGCAGAAGCTGTAGGG + Intronic
962902627 3:139774544-139774566 GGCTGTCTGGAAATGCTGTCTGG - Intergenic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
967351192 3:188515363-188515385 GGCTCTCATCAGAAACTGTCTGG + Intronic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
971911332 4:32800481-32800503 GGCTAGCTGTAGAATGTGTCTGG + Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975716359 4:77209164-77209186 GGGTAGCTGGAGAAGCTGACTGG - Intronic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977847096 4:101779251-101779273 AGCAATCTGCAGATGATGTCAGG + Intronic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978730784 4:112024253-112024275 GGCTCTCTGAGGAAGCTCTCAGG - Intergenic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980957729 4:139445887-139445909 AGTTATCTGCAGAAGATGTCAGG - Intergenic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982623345 4:157732931-157732953 GGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986935536 5:12880863-12880885 GGATATCTACATAAGCTGTTTGG - Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988169205 5:27632867-27632889 AGCGATCTGCAGAAGATGGCAGG + Intergenic
988188771 5:27901207-27901229 GGTTATCTGCAGAAGATGGCAGG - Intergenic
988562127 5:32290818-32290840 CGTTATCTGCAGAAGATGGCAGG - Intronic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989307506 5:39974650-39974672 AGCTATCTGAAGAAGATGGCAGG + Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
990629266 5:57650504-57650526 GACTATCTGCAGAAGCAGATGGG + Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
994235260 5:97355721-97355743 AGCTATCTAAAGAAGCAGTCTGG + Intergenic
994320830 5:98392647-98392669 GAGTAGCTGCAGACGCTGTCTGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995269560 5:110205495-110205517 AGCTATGTGCAGAAGATGGCAGG + Intergenic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
996164958 5:120212537-120212559 AGTTATCTGCAGAAGATCTCAGG + Intergenic
996769648 5:127072937-127072959 GGCTCTCTGGATGAGCTGTCTGG - Intronic
997798337 5:136834103-136834125 GGCTTGCTGCAGATGCTGTGGGG + Intergenic
997888160 5:137650270-137650292 AGCTTTCTGCAGGAGCTGACAGG - Intronic
998423174 5:142005791-142005813 GGCTATCTACAGGGGCTGTGTGG + Intronic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1001070359 5:168579775-168579797 GGCGATCTGCGGAAGCTGAGGGG - Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1007198538 6:40085051-40085073 GGCTATGTGCAGTGGCTTTCCGG - Intergenic
1007914791 6:45551464-45551486 GGCTATCAACAGAAGATCTCAGG + Intronic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009308634 6:62122274-62122296 GGTTATCTGCAGAAGATGGCAGG - Intronic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011356391 6:86476487-86476509 GGCTATTTTCAGGAGCTGCCGGG - Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1014416983 6:121195361-121195383 GGTTATCTGCAGAAGATGGTAGG - Intronic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018213824 6:161507550-161507572 GGCTGTCCCCAGCAGCTGTCTGG - Intronic
1018765296 6:166928117-166928139 GTCTGTCTGCAGAAGCTGTCAGG + Intronic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024441965 7:49430240-49430262 AGCTATCTGCACAATCTCTCTGG + Intergenic
1025094527 7:56087116-56087138 GGCTAACTTCAAAAGCTGACAGG + Intronic
1028660196 7:93262712-93262734 GGCTATCAGTTGGAGCTGTCTGG + Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030293167 7:107891749-107891771 GGCTATCTGTTGGAGCTGACTGG - Intronic
1031147880 7:118017056-118017078 GGCTAGATCCAGAAGCTCTCAGG + Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1033128046 7:138721926-138721948 GGGTATCTGCAGAAGTCCTCTGG + Exonic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1038433108 8:27515638-27515660 GGCATTCTGCAGACGCTGTGGGG + Intronic
1038922999 8:32106288-32106310 AGTTATATGCACAAGCTGTCTGG - Intronic
1039955409 8:42203386-42203408 GGGTGTCTGCAGCAGCTGCCCGG - Intronic
1040911943 8:52528388-52528410 TGTTATCTGCAGAAGATGGCAGG - Intergenic
1041601369 8:59720906-59720928 GGCTATCTACAAAAGGTGGCTGG + Intergenic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042747121 8:72120183-72120205 GGCTAGCTGTAGAATGTGTCTGG + Intergenic
1043259973 8:78184223-78184245 AGCTATCTGCAGAAGATGACAGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1046063987 8:109175192-109175214 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1049151977 8:141040919-141040941 TTCTAGCTGCAGAAGCTGGCAGG + Intergenic
1049458077 8:142704500-142704522 GGCTCTCTGGTGAAGCTTTCCGG + Exonic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050992795 9:12173759-12173781 GGCTAGCTGTAGATGATGTCTGG - Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1052521774 9:29557252-29557274 GGCTTACAGGAGAAGCTGTCTGG + Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1061416955 9:130452151-130452173 GGCTGTCTGCAGGGGCTGGCGGG + Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1185554431 X:1009375-1009397 GGCTTTTTGGAGAAGCTTTCAGG + Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192546290 X:72017575-72017597 TGGTATGTGCAGATGCTGTCTGG + Intergenic
1192673256 X:73168448-73168470 GGTTACCTGCAGAAGATGGCAGG + Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1195165350 X:102214608-102214630 GGCTAGCCACAGAAGCTGTGTGG - Intergenic
1195193508 X:102472483-102472505 GGCTAGCCACAGAAGCTGTGTGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196619780 X:117808498-117808520 GGCTTGCTGCAGCTGCTGTCGGG - Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199553543 X:149081483-149081505 GGCTTTCTGCAGGTGCTGTGGGG - Intergenic
1199924761 X:152450800-152450822 GGCTTTCTGCAGCAGCTGCTGGG + Intronic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200521268 Y:4211998-4212020 AGTTATCTGCAGAAGATTTCAGG - Intergenic
1201342787 Y:12952404-12952426 GGCTAGCTGTAGAATGTGTCTGG + Intergenic
1201798423 Y:17926667-17926689 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1201803130 Y:17979290-17979312 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1202182452 Y:22151145-22151167 GGATGTCTGCAAAAGATGTCTGG + Intergenic
1202208908 Y:22435257-22435279 GGATGTCTGCAAAAGATGTCTGG - Intergenic
1202359743 Y:24095357-24095379 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1202511035 Y:25574757-25574779 GGTTATCTGCAGAAGATGGCAGG + Intergenic