ID: 1129752772

View in Genome Browser
Species Human (GRCh38)
Location 15:78077543-78077565
Sequence AGCCGCGCTGGCTCCCGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 157}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129752768_1129752772 4 Left 1129752768 15:78077516-78077538 CCCGACAGCTTCTGCAGATAGCC 0: 1
1: 0
2: 1
3: 21
4: 357
Right 1129752772 15:78077543-78077565 AGCCGCGCTGGCTCCCGCGCCGG 0: 1
1: 0
2: 1
3: 10
4: 157
1129752765_1129752772 22 Left 1129752765 15:78077498-78077520 CCACGCAGGGGGCCCTTGCCCGA 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1129752772 15:78077543-78077565 AGCCGCGCTGGCTCCCGCGCCGG 0: 1
1: 0
2: 1
3: 10
4: 157
1129752767_1129752772 9 Left 1129752767 15:78077511-78077533 CCTTGCCCGACAGCTTCTGCAGA 0: 1
1: 0
2: 2
3: 15
4: 145
Right 1129752772 15:78077543-78077565 AGCCGCGCTGGCTCCCGCGCCGG 0: 1
1: 0
2: 1
3: 10
4: 157
1129752766_1129752772 10 Left 1129752766 15:78077510-78077532 CCCTTGCCCGACAGCTTCTGCAG 0: 1
1: 0
2: 1
3: 14
4: 172
Right 1129752772 15:78077543-78077565 AGCCGCGCTGGCTCCCGCGCCGG 0: 1
1: 0
2: 1
3: 10
4: 157
1129752769_1129752772 3 Left 1129752769 15:78077517-78077539 CCGACAGCTTCTGCAGATAGCCA 0: 1
1: 0
2: 0
3: 13
4: 169
Right 1129752772 15:78077543-78077565 AGCCGCGCTGGCTCCCGCGCCGG 0: 1
1: 0
2: 1
3: 10
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129752772 Original CRISPR AGCCGCGCTGGCTCCCGCGC CGG Exonic