ID: 1129754821

View in Genome Browser
Species Human (GRCh38)
Location 15:78091708-78091730
Sequence GAGGGGACTTTGGAGTAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 190}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129754821 Original CRISPR GAGGGGACTTTGGAGTAGAT GGG (reversed) Intronic
900836706 1:5010441-5010463 GAGGGGGCTGTAGAGTGGATGGG + Intergenic
902879205 1:19359895-19359917 ATGGGGACTTTGGAGCAGACCGG - Intronic
903112957 1:21153030-21153052 GAGGGAACTTTGGAGCATTTAGG - Intronic
905525734 1:38637717-38637739 GATTGGAGTTTTGAGTAGATAGG - Intergenic
905614795 1:39388410-39388432 GAGGGGACTCTGGATTTGTTAGG + Exonic
905910174 1:41648045-41648067 GAGGGGCTTTTGGAGAAGGTAGG - Intronic
908167349 1:61471526-61471548 GAGAGGATTTTGGAGAAGATTGG - Intergenic
909464966 1:75963339-75963361 GAGGAGAATTTGGATTAAATTGG - Intergenic
912536031 1:110371828-110371850 GAAGGGACTTTGGGGTGGAGTGG + Intronic
916061546 1:161102211-161102233 GAGGGGGATTTGTAGTAGAGTGG - Intronic
917835410 1:178937995-178938017 GAGGGGACTTTGGGGAACAGAGG + Intergenic
919621743 1:199871420-199871442 GAGGGAACTGGGGAGGAGATAGG - Intergenic
920054814 1:203184197-203184219 GAGGAGTCTTTGGATTAGGTGGG - Intronic
1063441314 10:6075605-6075627 GAGGGGACTGTGGGGTGGAGGGG - Intergenic
1064361242 10:14666746-14666768 CAGGGAACTTGGGAGGAGATGGG + Intronic
1069830359 10:71279076-71279098 GAGGAGACTTCAGAGCAGATGGG - Intronic
1071481578 10:86068978-86069000 TAGGGGCCTGTGGAGCAGATTGG - Intronic
1076035244 10:127195030-127195052 GAGGTGCCTCTGGAGTAAATAGG - Intronic
1076715341 10:132361176-132361198 GAGGGGACCCTGGGGTAGCTCGG - Intronic
1077744269 11:4882856-4882878 GAGGGGTCTTAGGGGAAGATGGG + Exonic
1078545067 11:12241202-12241224 GAGGGGACTTTGATCCAGATGGG + Intronic
1079622790 11:22574619-22574641 GAGGGTAATTTTGAGTAGAAAGG + Intergenic
1079996313 11:27298823-27298845 GAGGTGACATTGTAGTAGGTGGG - Intergenic
1080174583 11:29346795-29346817 GAGACGACTTTGGAGTTGATAGG + Intergenic
1081571246 11:44292693-44292715 GACTGGGATTTGGAGTAGATGGG + Intronic
1081794958 11:45812662-45812684 GTGGGGCCTTTGGAGCTGATTGG - Exonic
1085911209 11:80829055-80829077 GAGGGACCTTTGGATTACATGGG - Intergenic
1086337042 11:85810740-85810762 GAGGTGGCTCTGGAGTAGGTGGG + Intronic
1086816226 11:91374946-91374968 GATGCTACTTTGAAGTAGATGGG - Intergenic
1087004240 11:93453494-93453516 GAGGTCATTTTGGAGTAGAGTGG + Intergenic
1087926916 11:103929433-103929455 GAGGGCACTTTGGAGTTTATTGG - Intronic
1090097131 11:123753504-123753526 GAGAGGATTTTGGAGAAGTTTGG - Exonic
1091538364 12:1435323-1435345 GAGGGGAGTTAGGAGAAGAAAGG + Intronic
1091962822 12:4712918-4712940 GAGGAGACTTTGCAGAAGCTTGG + Intronic
1092396194 12:8128911-8128933 CCTGGGACTTTGGAGCAGATGGG - Intronic
1092823778 12:12377945-12377967 GAGGGGACATTGAAGGATATTGG + Intronic
1094208397 12:27864591-27864613 GAGGAAACTTTGGAGGTGATCGG - Intergenic
1096078662 12:48819620-48819642 CAGGGGGCTGTGGAATAGATGGG - Intronic
1096531450 12:52245161-52245183 GAGGGGACTTTGGCTTAGCAGGG + Intronic
1096872234 12:54600412-54600434 GGGGAGATTTTGGAGTAGAACGG + Intergenic
1096980099 12:55723818-55723840 GAGGGGACTTTGAGGGACATGGG - Exonic
1097022759 12:56032545-56032567 GAGGAGACTGTGGAGGAGAGTGG - Exonic
1098968724 12:76825047-76825069 GAGGGGATTTGGGAGTAGGAGGG + Intronic
1100807464 12:98301664-98301686 GACGGGACTTTGGAGTGCTTAGG + Intergenic
1103656964 12:122478881-122478903 CAGGGGACTCTGAAGTAGACTGG + Intronic
1105940125 13:25140561-25140583 GCTGGGACCTTGGAGTAGAGAGG + Intergenic
1106213283 13:27670705-27670727 GAGTGTAATTTGGAGTAGATAGG - Intergenic
1106930194 13:34654943-34654965 GAAGGGAATTCGGAATAGATTGG - Intergenic
1107957986 13:45535227-45535249 AAGTTGAGTTTGGAGTAGATTGG + Exonic
1108959267 13:56203137-56203159 CAGCTGACTTTGGAGTATATTGG - Intergenic
1114007693 14:18332542-18332564 GAGGGGAGTTTGGGGTTGCTTGG - Intergenic
1114182430 14:20377916-20377938 GAGGAGACTGTGGAGGAGCTTGG - Intronic
1114532859 14:23406210-23406232 ATGGGGAGTGTGGAGTAGATGGG - Intronic
1116477167 14:45353530-45353552 GAGGGCATTAGGGAGTAGATTGG + Intergenic
1118838635 14:69494737-69494759 AAGGGGACTTTGGAATAGGGTGG + Intronic
1122469008 14:101953448-101953470 GAGGTGGCTTTGGAGGAGTTTGG - Intergenic
1124130746 15:26983402-26983424 GATAGCACTTCGGAGTAGATAGG + Intronic
1126229713 15:46310480-46310502 GAAGGGGCTTTGGAATAGGTAGG + Intergenic
1127678852 15:61273121-61273143 GAGGTGAGTCTGGGGTAGATAGG - Intergenic
1129754821 15:78091708-78091730 GAGGGGACTTTGGAGTAGATGGG - Intronic
1130358787 15:83160644-83160666 GAGAGGACTCTGGAGTAGAGGGG + Intronic
1130545802 15:84857157-84857179 GAGGGGAGTGTGGAGCAGGTGGG + Exonic
1130633969 15:85598773-85598795 GAAGGGACAGTGGTGTAGATAGG - Intronic
1131846809 15:96497111-96497133 GAGGAGACATTGGAGTTGAGGGG + Intergenic
1134612276 16:15618797-15618819 TAGGGGCCATTGGAGTAGCTGGG - Intronic
1135564308 16:23499944-23499966 GAGGGGACTCTGGGCCAGATTGG + Intronic
1139222480 16:65197953-65197975 GAAGGGAATTTTCAGTAGATGGG - Intergenic
1141682729 16:85553790-85553812 GAGGGCAAATTGGAGGAGATGGG - Intergenic
1143407911 17:6690344-6690366 GTGGGGACTTGGGAGTAGGTAGG - Intronic
1144155656 17:12498084-12498106 GGAGGGACTCTGGAGTAGATGGG - Intergenic
1144948030 17:18979760-18979782 GAGGGGACTCTGGAGTAGTCAGG + Intronic
1145977471 17:28992719-28992741 GAGGGGACACTGGAGGAGAGAGG - Intronic
1147115923 17:38299694-38299716 GAGTTGACTTTGGAGTGTATAGG + Intronic
1147378748 17:40039445-40039467 GAGGGCACTTAGGAGTAGTTGGG - Intronic
1147488904 17:40845394-40845416 GAGGAGAATTTTGAGAAGATGGG + Intergenic
1147978497 17:44261092-44261114 AAGGGGACTTTGGAGTCATTGGG + Intronic
1148076200 17:44936417-44936439 GAGGGGACCTTGGAGTACTGAGG - Intronic
1148413755 17:47489918-47489940 GAGTTGACTTTGGAGTGTATAGG - Intergenic
1149500544 17:57149188-57149210 GAGGGTAATGTGGAGGAGATGGG - Intergenic
1152792762 17:82290993-82291015 GAGGGGTCTTTTCAGTAGTTGGG + Intergenic
1154529768 18:15331421-15331443 GAGGGGAGTTTGGGGTTGCTTGG + Intergenic
1156184728 18:34648512-34648534 AAAGGGAAATTGGAGTAGATGGG + Intronic
1156254238 18:35379673-35379695 GAGGGGATTTTTGGGTAGACTGG + Intergenic
1157769063 18:50328664-50328686 GAGGGCACTTGGGGGTAAATGGG - Intergenic
1159959530 18:74544881-74544903 GAGGTCACTCTGGAGTAGAGTGG + Intronic
1161345910 19:3768610-3768632 TAGGGGACTCTGGAGTGGAGGGG + Intergenic
1163558739 19:18006917-18006939 GATGGGTCTTTGGAGTTGAAAGG - Intronic
1164960766 19:32427535-32427557 AAGGAGACTTTAGAATAGATAGG + Intronic
1165449164 19:35872222-35872244 GGGGGTACTTGGGAGTAGAGGGG + Intronic
1165785590 19:38459898-38459920 GGGGGGTCTTTGGAATAAATGGG - Intronic
1165996739 19:39849002-39849024 GAGGTGACTTGGGAGTCAATGGG - Intergenic
1167337589 19:48896313-48896335 GTGGGGACTTGGCAGTGGATGGG - Intronic
1167727915 19:51231166-51231188 GTGAGGACTTTGGGGTAGAAAGG - Intronic
1168661966 19:58174257-58174279 GAGAGGTCTCTGGGGTAGATGGG + Intergenic
925923522 2:8654164-8654186 GTGGTGATTTTGGAGTAGGTGGG - Intergenic
926178633 2:10619711-10619733 CAGTGGACTTTGAAGAAGATTGG - Intronic
929664388 2:43822500-43822522 GAGAGGACTCTGAAGTAGCTAGG - Intronic
933673620 2:85033100-85033122 TAGGTGAATTTGGAGTAGCTGGG - Intronic
936605076 2:113943889-113943911 GAAGGGGCTGTGGAGTAGAAAGG + Intronic
938528862 2:132162861-132162883 GAGGGGAGTTTGGGGTTGCTTGG + Intronic
939665687 2:144948562-144948584 GAAGGGTCTTTGGAGTATTTGGG + Intergenic
940846403 2:158647126-158647148 AAGGGGACTTTATAGGAGATGGG - Intronic
943770620 2:191712529-191712551 AAGGAGGCTCTGGAGTAGATAGG + Intergenic
944404721 2:199370664-199370686 GAGGGGAATTTGGATTATCTGGG - Intronic
944651982 2:201839488-201839510 GTAGGGACTGTGGATTAGATAGG + Intronic
948828921 2:240588003-240588025 GATGTGGGTTTGGAGTAGATTGG + Intronic
1168973339 20:1945950-1945972 AAGGGCACTGTGGAGTTGATGGG - Intergenic
1169590388 20:7134262-7134284 GTGGGGACTTTGGAGGACACTGG - Intergenic
1170184332 20:13571453-13571475 AATGGGACTTTGAAGTAGATTGG - Intronic
1170960226 20:21019034-21019056 AAGGGGACTTAGTAGTAGCTCGG + Intergenic
1172667677 20:36612075-36612097 GAGGGTCCTTTGGACTGGATAGG - Exonic
1172739328 20:37153243-37153265 CAGGGGACTTAGGTGTAGAGAGG + Intronic
1172950574 20:38720986-38721008 GAGAGGATTTTGCAGTAGACTGG - Intergenic
1174733425 20:52940526-52940548 GAGGGGACTTGGGTGTGGAATGG - Intergenic
1175145123 20:56890109-56890131 GAGGGGAGATTGGTGTAGATTGG - Intergenic
1175387056 20:58604206-58604228 GAGGGGGCTTTGGATGAGGTGGG + Intergenic
1176767644 21:13037051-13037073 GAGGGGAGTTTGGGGTTGCTTGG - Intergenic
1179138405 21:38700586-38700608 CAGGGGAGTTTGGAGTGGAGTGG - Intergenic
1179209975 21:39316013-39316035 GGGGTGACTTTGGAGAGGATGGG + Intronic
1180432200 22:15263352-15263374 GAGGGGAGTTTGGGGTTGCTTGG - Intergenic
1181039336 22:20184473-20184495 TAGGGGACTGTGGGGTACATGGG - Intergenic
949204746 3:1424421-1424443 GATGGGCCTTTGGTGTAGGTTGG + Intergenic
950667675 3:14506973-14506995 GAGGGGACCTGGGAGGAGAGAGG + Exonic
952896007 3:38079503-38079525 TAGGGGGCTTTGGAGGCGATCGG + Intronic
954943035 3:54392661-54392683 GTGGGGGCTTTGGAGTGGAGGGG + Intronic
956380871 3:68663303-68663325 GAGGGGACTTGGGAATAGGAGGG - Intergenic
959002688 3:100982748-100982770 TAGGGGAGTTTGGAGAGGATGGG + Intronic
959405040 3:105951273-105951295 GATAGGACTTCGAAGTAGATTGG - Intergenic
965109537 3:164402601-164402623 GAAGGGAGTTTGGTGTAGAGGGG + Intergenic
965679271 3:171233686-171233708 AAGAGGACTTGGGAATAGATTGG + Intronic
967837236 3:193974945-193974967 GAGGGGCTTTGGGAGTGGATAGG - Intergenic
970342695 4:15123098-15123120 TAGGGGTTTTGGGAGTAGATGGG - Intergenic
973771373 4:54210098-54210120 GAGATGACATTGGAGAAGATAGG + Intronic
977986809 4:103392175-103392197 GATGGGAGGTTGGAGTAGAGTGG - Intergenic
980763101 4:137263042-137263064 CAGGGAACTTTGCAGTGGATAGG - Intergenic
981269647 4:142830498-142830520 GAGGGGAATATGGAGTGGAGAGG + Intronic
981533193 4:145773011-145773033 GAGGGGGCTTTGGAGCAGGATGG + Intronic
982124294 4:152171154-152171176 GAGGACACTTGGGAGTTGATGGG - Intergenic
985795407 5:1958328-1958350 GTGGGGCCTTGGGAGTTGATTGG + Intergenic
988492309 5:31715214-31715236 GAGAGGGCTTTGTAGTAGAGAGG + Intronic
988630645 5:32927740-32927762 GAGGGGACAGGGGAGTTGATGGG - Intergenic
992633847 5:78708304-78708326 GATGGGATTTTGGAGTACAGTGG + Intronic
993530875 5:89023884-89023906 GAGGGGAGTGGGGAGTAGAATGG + Intergenic
994200106 5:96964035-96964057 GAGGGGACAAGGGAGAAGATGGG - Intronic
995341948 5:111070465-111070487 GAGGGGACCTGGGTGTAGAGAGG + Intronic
995974087 5:118009620-118009642 GAGTGCACTTTGGAGTAGGGTGG - Intergenic
996058622 5:119008248-119008270 GTGGGGCCTTTGGAGATGATAGG - Intergenic
997439140 5:133897060-133897082 GTGGGGACTTTGGAGGAAGTTGG - Intergenic
997823929 5:137089685-137089707 GATGGGACTTTGGAGTTGAGGGG - Intronic
999245983 5:150155040-150155062 GAGGGGAATTGGGAGAAGGTAGG - Intronic
1000668628 5:164031207-164031229 GAGGGGATAGTGGAGAAGATAGG + Intergenic
1001698470 5:173689968-173689990 AAGGGGACTTTGGGGAAGGTGGG + Intergenic
1001714259 5:173802174-173802196 GAAGGGACATTGGAGCAGAGTGG + Intergenic
1002392910 5:178929744-178929766 GAGGTGACTTTGGAATAACTGGG - Intronic
1004573887 6:16873988-16874010 CAGGCCCCTTTGGAGTAGATTGG + Intergenic
1005667155 6:28069655-28069677 CAGGGGACTTTGAGGGAGATGGG - Intergenic
1006202151 6:32303562-32303584 GAGGTGACTTTCTTGTAGATAGG + Intronic
1006923385 6:37640689-37640711 GGGGGGACATTGGAGCTGATGGG + Intronic
1009379859 6:63013865-63013887 GGGGGGACTTGGGAGGAGGTAGG - Intergenic
1014154015 6:118090982-118091004 GATGGGACTTGTCAGTAGATTGG + Intronic
1016676126 6:146770935-146770957 GAGGGGAGGTTGAAGTAGAATGG - Intronic
1018414716 6:163591070-163591092 GAGGGGACTATAGAGGGGATGGG - Intergenic
1018967459 6:168499777-168499799 TAGGGGACTGTGGAGCAGATTGG + Intronic
1019663132 7:2236824-2236846 GAGGGGACTGTTGGGGAGATGGG + Intronic
1022820311 7:33953369-33953391 GACAGGACTTGGAAGTAGATGGG + Intronic
1025237021 7:57241410-57241432 GAGGTGACACTGGAGGAGATTGG + Intergenic
1026361917 7:69609678-69609700 GAGTGAACTTTGGAGTATAGTGG + Intronic
1026535130 7:71232905-71232927 GACTGGACTTTGGACGAGATTGG - Intronic
1027533259 7:79362769-79362791 GAGGGGAATTAGGAATAGAGGGG + Intronic
1032719361 7:134538145-134538167 GAGGGGTCTTTGGAGCTGAGTGG + Intronic
1032868395 7:135953100-135953122 AAGGGGAGTTTGGAGGAGTTTGG - Intronic
1033130784 7:138743917-138743939 CAGGGGACTCTGGAGGAGAGGGG - Intronic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1034244441 7:149633962-149633984 GAGGGGACTCTGGGGTAGGGTGG + Intergenic
1034404136 7:150890865-150890887 GAGGGGACTTGGGGGGAAATTGG + Intergenic
1034455033 7:151165438-151165460 GAGATGACTTTGGAGGAGATAGG - Intronic
1034641819 7:152610153-152610175 TAGGGAACTTTAGAATAGATGGG + Intergenic
1034823780 7:154241592-154241614 GGAGGCATTTTGGAGTAGATGGG - Intronic
1037096307 8:14991759-14991781 GAGTAGATTTGGGAGTAGATTGG - Intronic
1037096375 8:14992213-14992235 GAGTAGATTTGGGAGTAGATTGG - Intronic
1037096395 8:14992337-14992359 GAGTAGATTTGGGAGTAGATTGG - Intronic
1037096414 8:14992461-14992483 GAGTAGATTTGGGAGTAGATTGG - Intronic
1037096502 8:14992898-14992920 GAGTAGATTTGGGAGTAGATTGG - Intronic
1037096531 8:14993028-14993050 GAAGAGATTTGGGAGTAGATTGG - Intronic
1037836662 8:22218730-22218752 GAAGGGACTTTGGAGTCTTTTGG - Intergenic
1038141523 8:24850343-24850365 GAGAGAAGTTTGGATTAGATTGG - Intergenic
1039769084 8:40664666-40664688 GAGGGGATTTGGGAGTGGCTTGG - Intronic
1042751422 8:72162065-72162087 GAGGGGAATTTGGGGAAGACAGG + Intergenic
1042763967 8:72300597-72300619 GAGGGGAATTTGTGGAAGATAGG + Intergenic
1046120076 8:109835274-109835296 GTGGGGACTGAGGAGTAGAAGGG - Intergenic
1053707477 9:40769190-40769212 GAGGGGAGTTTGGGGTTGCTTGG + Intergenic
1053728965 9:41033364-41033386 GTGGGGATTTTGGGGTAGAAGGG - Intergenic
1054417389 9:64889958-64889980 GAGGGGAGTTTGGGGTTGCTTGG + Intergenic
1054699546 9:68398719-68398741 GTGGGGACTTTGGGGTAGAAGGG + Intronic
1055113773 9:72585823-72585845 GAGGTGAGTGTGGAGTGGATGGG + Intronic
1056879947 9:90381373-90381395 GAAGGGACTTTGGAGAGGTTGGG + Intergenic
1061322419 9:129839587-129839609 GAGGGGACTGTGGAGGGGGTGGG + Intronic
1061411708 9:130425527-130425549 GAGGAGGCTTGGGAGAAGATGGG - Intronic
1062080258 9:134620007-134620029 AAGGGTACATTGGACTAGATGGG - Intergenic
1187040441 X:15589407-15589429 GAGGAGACTATGAAGTAAATGGG - Exonic
1187345108 X:18456620-18456642 GAGAGGATTTGAGAGTAGATAGG + Intronic
1187357658 X:18592427-18592449 GAGGAGCATTTGGATTAGATAGG + Intronic
1190318544 X:49166058-49166080 GACGGGACTACGGATTAGATTGG - Exonic
1192548372 X:72032481-72032503 GAGGGGAGTGGGTAGTAGATGGG - Intergenic
1192615850 X:72621283-72621305 GAGGGGACTTTGGTGAGGAAGGG + Intronic
1197093695 X:122570038-122570060 GAGGGCATTTTCAAGTAGATCGG + Intergenic
1198176708 X:134163689-134163711 GAGGTGACATTTGAGTAGATGGG - Intergenic
1198661667 X:138975581-138975603 GAAGGTTCCTTGGAGTAGATAGG + Intronic