ID: 1129755252

View in Genome Browser
Species Human (GRCh38)
Location 15:78094188-78094210
Sequence ATCTTGTCCTACAGGTAAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 125}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129755247_1129755252 2 Left 1129755247 15:78094163-78094185 CCTCAGTGACCGAGCCACTGGCT 0: 1
1: 0
2: 0
3: 12
4: 168
Right 1129755252 15:78094188-78094210 ATCTTGTCCTACAGGTAAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 125
1129755244_1129755252 11 Left 1129755244 15:78094154-78094176 CCTTATCCGCCTCAGTGACCGAG 0: 1
1: 0
2: 0
3: 7
4: 38
Right 1129755252 15:78094188-78094210 ATCTTGTCCTACAGGTAAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 125
1129755243_1129755252 15 Left 1129755243 15:78094150-78094172 CCTTCCTTATCCGCCTCAGTGAC 0: 1
1: 0
2: 0
3: 10
4: 148
Right 1129755252 15:78094188-78094210 ATCTTGTCCTACAGGTAAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 125
1129755245_1129755252 5 Left 1129755245 15:78094160-78094182 CCGCCTCAGTGACCGAGCCACTG 0: 1
1: 0
2: 1
3: 12
4: 117
Right 1129755252 15:78094188-78094210 ATCTTGTCCTACAGGTAAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 125
1129755248_1129755252 -7 Left 1129755248 15:78094172-78094194 CCGAGCCACTGGCTACATCTTGT 0: 1
1: 0
2: 2
3: 15
4: 165
Right 1129755252 15:78094188-78094210 ATCTTGTCCTACAGGTAAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129755252 Original CRISPR ATCTTGTCCTACAGGTAAGA GGG Exonic
901470358 1:9451797-9451819 ACCTGGTTCCACAGGTAAGAAGG + Intergenic
901841120 1:11954815-11954837 ATCTGCTCCTGCAGGAAAGAAGG - Exonic
901881653 1:12197594-12197616 ATCTAATCCTACAGGAAAAATGG - Intronic
901883442 1:12207174-12207196 CTCTTGGCCTGCAGGTCAGAGGG - Exonic
903852127 1:26314108-26314130 ATCTTGTCCTGCTGCTCAGAGGG + Intronic
905799197 1:40832604-40832626 GTCTTCTCCTTCAGCTAAGATGG - Intronic
906024999 1:42665918-42665940 ATCTTGCCCTTCAGCTAACATGG + Intronic
906272943 1:44495769-44495791 ATATTGGCCCAGAGGTAAGAGGG + Intronic
907217870 1:52881456-52881478 ATGTTGTTCTACAGGTCAGATGG - Exonic
908020547 1:59893821-59893843 ATTTTGTCTTACAGGAAAGCGGG - Exonic
908103623 1:60816840-60816862 CTCTAGTCCTTTAGGTAAGATGG + Intergenic
908149948 1:61289448-61289470 AGCTTGTCCTACAGTCAAGAAGG + Intronic
910559162 1:88571766-88571788 AACTTGTCATACAGGGATGATGG - Intergenic
911998748 1:104801807-104801829 ATTTTGAACTATAGGTAAGATGG - Intergenic
913253944 1:116937492-116937514 ATTTTGTCCTATAGGTGATAAGG + Intronic
915736328 1:158087847-158087869 ATCTTGGGCTACAGGTGAGGGGG + Exonic
916275560 1:162989797-162989819 AACCTGTCCTAGGGGTAAGAAGG - Intergenic
921199815 1:212793769-212793791 AGCTTGTGCTATAGGGAAGATGG + Intronic
921681306 1:218035348-218035370 TTCTTGTCCTTCAGATAATAAGG - Intergenic
921987980 1:221333376-221333398 ATTTTATCCTACAGGAAAAAAGG - Intergenic
922417611 1:225435921-225435943 ATGTTCTCCTAAAGGTCAGAAGG + Intergenic
923116572 1:230945775-230945797 ATCATGTCTTACAGAGAAGAAGG + Intronic
923166192 1:231365043-231365065 ATCTTTCAGTACAGGTAAGAAGG + Exonic
924043665 1:240007957-240007979 AACTTCTCCTGCAGCTAAGAGGG + Intergenic
1064577104 10:16757579-16757601 ACCTTGCAATACAGGTAAGATGG + Intronic
1065938855 10:30545846-30545868 ATCTTGTCCTAAATGAAGGAAGG + Intergenic
1066240577 10:33530628-33530650 ATCTAGTCCTACAGAAGAGAGGG + Intergenic
1067310892 10:45112539-45112561 ACCTTGTAATACAGGCAAGATGG + Intergenic
1069342901 10:67433203-67433225 ATTTTGTACTTCAGGTAATAGGG + Intronic
1074410529 10:113224391-113224413 ATCTTGTCCTGCAGGGAACTAGG - Intergenic
1076224459 10:128762813-128762835 TTCTTGTCCTGAAGGTGAGATGG + Intergenic
1080754682 11:35185395-35185417 ATCTTTTCCCACAGATAAAAAGG - Intronic
1081671006 11:44942745-44942767 ATCTTGACCTCCAGGGAGGAGGG + Intronic
1083035832 11:59636486-59636508 ATTTTGTCGTACAGTTAAAATGG + Intergenic
1087044390 11:93832048-93832070 AATTTATCCTACAGATAAGATGG + Intronic
1087133139 11:94686550-94686572 CTCTTATCCTAGAGTTAAGAGGG - Intergenic
1091929468 12:4383282-4383304 ATCTTGACCTGCAGTTAGGATGG - Intergenic
1091987402 12:4922837-4922859 ATATTGCTCAACAGGTAAGAAGG - Intronic
1092632623 12:10399254-10399276 ATCTTGTGGAACAGGTAGGACGG + Intronic
1092985426 12:13840455-13840477 AAGTTGTCCAGCAGGTAAGAGGG - Intronic
1097563652 12:61239891-61239913 ATCTTTTCCTTCAAGTAAGCGGG + Intergenic
1099056541 12:77848736-77848758 ATCTTGTTCAACAGATAATAAGG - Intronic
1099323596 12:81182291-81182313 ATGCTGTCCTTCAGGAAAGAAGG + Intronic
1101537980 12:105637850-105637872 ATCTTGTCATGCAGGTCTGATGG - Intergenic
1101538234 12:105640406-105640428 TTCTTGTGCTAGAGCTAAGAGGG - Intergenic
1102655485 12:114479550-114479572 ATCGTGGGCTGCAGGTAAGAGGG - Intergenic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1104831528 12:131755556-131755578 TTCTTCTCCTACAGGTGAAAGGG + Intronic
1107183311 13:37487356-37487378 AACTTGTCCCACAGTTCAGAAGG + Intergenic
1107448001 13:40485258-40485280 AACTTGTCCTACAGAACAGAAGG + Intergenic
1109529049 13:63616362-63616384 ATGTTCTCCTACAACTAAGATGG + Intergenic
1111401578 13:87743651-87743673 ATCTGGTAATACATGTAAGATGG - Intergenic
1112862071 13:103843411-103843433 ATCTTACCCTAGAGGGAAGAAGG + Intergenic
1127733014 15:61817454-61817476 ATCTTCTCTTACAGGTCAGGAGG - Intergenic
1129755252 15:78094188-78094210 ATCTTGTCCTACAGGTAAGAGGG + Exonic
1132599109 16:766063-766085 AGCCTGTCCTTCAGGCAAGAAGG + Exonic
1134198137 16:12174950-12174972 ATCTTGTCCCTGAGGTAAGAGGG + Intronic
1137840631 16:51637509-51637531 ATCTTATCCTTCAGGCAAAATGG - Intergenic
1140738542 16:77921132-77921154 ATCTTATCTTAATGGTAAGAAGG + Intronic
1153268529 18:3295981-3296003 ATCTAGTGATGCAGGTAAGAGGG - Intergenic
1156740596 18:40322938-40322960 ACTTTGTCCCACAGGTCAGAAGG + Intergenic
1157371410 18:47115928-47115950 ATCTTTTTCTTCAGGAAAGATGG - Intronic
1158779943 18:60636545-60636567 ATCTTAGCCTACAGGTACAAAGG + Intergenic
1166861795 19:45815626-45815648 ATCTTCTCCAACAGGTGCGAGGG + Exonic
927386328 2:22538066-22538088 ATTATGTCCTACAGGTATCAAGG + Intergenic
928276635 2:29906859-29906881 GACTTGTCCAACAGGTAACAGGG + Intronic
929441477 2:41968601-41968623 AATTTGTCCTAGAGGGAAGAGGG - Intergenic
933252824 2:80047930-80047952 ATCTTATCCTACAAATAATAGGG + Intronic
935871552 2:107455981-107456003 GTCCTGTCCCACAGGCAAGATGG - Intergenic
937922387 2:127139981-127140003 ACCTCCTCCTACAGGTAGGATGG + Intergenic
939011107 2:136846790-136846812 ATGCTGTCCTAAAGGTAATATGG - Intronic
943655717 2:190506561-190506583 ATATTGTCCTTCATGTCAGATGG + Exonic
946179103 2:217939528-217939550 ATCTTCTCCTGCAGAGAAGATGG - Intronic
1169355604 20:4902433-4902455 TTCTGGGGCTACAGGTAAGATGG - Exonic
1170594532 20:17794986-17795008 ATCTTGTCCTCCAGGTCATGAGG - Intergenic
1174252072 20:49227276-49227298 ATTTTGTCCTACAGTTATGTGGG - Intronic
1174585827 20:51607446-51607468 TTCTTGTTCTACAGGCAAGAAGG + Intronic
1175520749 20:59601323-59601345 ATATTATCCTACAGTTAGGATGG + Intronic
1175926875 20:62475535-62475557 GTCTTGACCTGCAGGGAAGAGGG + Exonic
1179230675 21:39501006-39501028 ATCTTGACCTAGAAGTTAGACGG + Intronic
1179723096 21:43326625-43326647 ACCTTGTCCCACTGGTAGGAGGG - Intergenic
1184805731 22:46793828-46793850 GTCCTGTCCTGCAGGTACGATGG + Exonic
949977901 3:9477470-9477492 ATCTTGTCCAAAAGAAAAGAAGG - Exonic
957864837 3:86008255-86008277 ATTTTATGCTACAGGTATGAAGG - Intronic
959033298 3:101329338-101329360 ATCTGGCCCTACAGGCAAGAAGG + Intronic
959411869 3:106034335-106034357 ATCTTGTCTGAAAAGTAAGATGG - Intergenic
960599861 3:119445935-119445957 ATGTCTTCCTGCAGGTAAGAGGG - Intronic
962986642 3:140542139-140542161 AATGTGTCCAACAGGTAAGAGGG - Intronic
963419868 3:145048108-145048130 CTCCTGTTCTACAGGGAAGAAGG + Intergenic
965170751 3:165260882-165260904 ATATTCTCCAACAGATAAGATGG - Intergenic
965547680 3:169932565-169932587 ATTGTGTCCTACAGTTAGGAAGG - Intronic
967660418 3:192101739-192101761 ATCATATCATACAGGTAAAATGG + Intergenic
970740895 4:19236560-19236582 ATCATGTCCTACAGTTATGGAGG + Intergenic
971701662 4:29984914-29984936 ATATTCTACTACAGGTAAGCTGG - Intergenic
979738374 4:124118074-124118096 ATCTAGTCCTACAGGTCCTATGG - Intergenic
981167562 4:141580357-141580379 ATCTTCTCTTCTAGGTAAGATGG + Intergenic
981470032 4:145122825-145122847 ATCATGTCCAACAAGTAAAAAGG - Intronic
985944746 5:3170328-3170350 ATCTTGTTCTACCTTTAAGATGG - Intergenic
987967608 5:24896009-24896031 ATCTTGTCCTACAATCAAGAAGG + Intergenic
988087818 5:26494514-26494536 TTCTTGTGATACAGGAAAGAAGG + Intergenic
988207261 5:28155492-28155514 ATCTTTTCCTATAGATAAGCAGG + Intergenic
991500311 5:67269803-67269825 ATTATGTCCTGCAGATAAGAGGG - Intergenic
994103943 5:95924471-95924493 AGCTTTTCCTACAGGTCAGTTGG + Intronic
996004018 5:118399675-118399697 CTCTTCTCTTACAGGTAAGATGG - Intergenic
996857583 5:128027059-128027081 ATGTGGTCCTACAGGGAAAATGG + Intergenic
1000026197 5:157361323-157361345 CTCTGGGCCTGCAGGTAAGAGGG + Intronic
1006373467 6:33659217-33659239 AGCTTGTCCGGCAGGTCAGATGG - Intronic
1010135234 6:72543602-72543624 AACTTGTCCCTCAGGTAAGGAGG - Intergenic
1010211057 6:73363202-73363224 ATTGTGTCCTCCTGGTAAGAAGG - Exonic
1013542631 6:111125789-111125811 AACTTGGCCAACAGGTAGGATGG + Intronic
1016881879 6:148919582-148919604 ATCTTGTCCCACAGGTACCATGG + Intronic
1018096949 6:160396451-160396473 ATCTTGGCATACAGCTGAGAAGG + Intronic
1023813082 7:43927062-43927084 TTTTTATCCTGCAGGTAAGAGGG + Intronic
1026166600 7:67915701-67915723 TTCTTACCCTACAGGTCAGAGGG + Intergenic
1033328791 7:140401029-140401051 AGCTTGGGCTACAGGAAAGAAGG - Intronic
1037019841 8:13956794-13956816 AACTTATCCTTGAGGTAAGATGG - Intergenic
1041532281 8:58882558-58882580 ATCTTGTCCTTGAAGTCAGATGG + Intronic
1041707270 8:60859825-60859847 ATTTTGTCCTGGAGGTAATAGGG + Intronic
1047205529 8:122800223-122800245 AGCTTGTCCTGCAGTTCAGATGG + Intronic
1053266617 9:36719741-36719763 ATCTTGTCATACAGCCAGGAAGG + Intergenic
1057306315 9:93914196-93914218 TCCTTGTTCTACAGGTGAGAAGG + Intergenic
1058840242 9:108900251-108900273 AGCTTGTATTACAGGTAAGCTGG - Exonic
1059738059 9:117122030-117122052 CTCTTATCCTACAGGTGATATGG - Intronic
1059774057 9:117457344-117457366 AGCTTTTCCTCCAGGTAAGCTGG - Intergenic
1185941742 X:4328726-4328748 ACCTTCTTCAACAGGTAAGAAGG + Intergenic
1188650162 X:32622563-32622585 ATTTTGTCCTATAGGAAGGAAGG - Intronic
1192996401 X:76517234-76517256 CTCTTGACTTAGAGGTAAGAGGG - Intergenic
1193997626 X:88385446-88385468 ATCATCTCCTTCAGATAAGAAGG + Intergenic
1194566022 X:95489091-95489113 ATATTGTCTTGCAGGTAAGGGGG + Intergenic
1197130699 X:123002519-123002541 TTATTGACCTACAGGTATGATGG + Intergenic
1197822308 X:130553701-130553723 GCCTTGTCCTACATGAAAGAAGG - Intergenic
1198330034 X:135613922-135613944 ATAGTGTCCTGCAGGGAAGAAGG + Intergenic
1198362702 X:135911383-135911405 ATAGTGTCCTGCAGGGAAGAAGG + Intronic
1198733916 X:139765451-139765473 ATATTGTCATCCATGTAAGAAGG + Intronic