ID: 1129757006

View in Genome Browser
Species Human (GRCh38)
Location 15:78104801-78104823
Sequence CTTCACATTGTGAAGGAGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 200}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129756999_1129757006 0 Left 1129756999 15:78104778-78104800 CCTTGGGCCCACTGCACCCACAG 0: 1
1: 0
2: 6
3: 39
4: 476
Right 1129757006 15:78104801-78104823 CTTCACATTGTGAAGGAGGCCGG 0: 1
1: 0
2: 3
3: 16
4: 200
1129756994_1129757006 27 Left 1129756994 15:78104751-78104773 CCCAGAGGCAGAGACAGGAGCAA 0: 1
1: 0
2: 4
3: 88
4: 1172
Right 1129757006 15:78104801-78104823 CTTCACATTGTGAAGGAGGCCGG 0: 1
1: 0
2: 3
3: 16
4: 200
1129756995_1129757006 26 Left 1129756995 15:78104752-78104774 CCAGAGGCAGAGACAGGAGCAAG 0: 1
1: 0
2: 9
3: 190
4: 3677
Right 1129757006 15:78104801-78104823 CTTCACATTGTGAAGGAGGCCGG 0: 1
1: 0
2: 3
3: 16
4: 200
1129757000_1129757006 -7 Left 1129757000 15:78104785-78104807 CCCACTGCACCCACAGCTTCACA 0: 1
1: 0
2: 4
3: 28
4: 418
Right 1129757006 15:78104801-78104823 CTTCACATTGTGAAGGAGGCCGG 0: 1
1: 0
2: 3
3: 16
4: 200
1129757001_1129757006 -8 Left 1129757001 15:78104786-78104808 CCACTGCACCCACAGCTTCACAT 0: 1
1: 0
2: 3
3: 34
4: 357
Right 1129757006 15:78104801-78104823 CTTCACATTGTGAAGGAGGCCGG 0: 1
1: 0
2: 3
3: 16
4: 200
1129756998_1129757006 1 Left 1129756998 15:78104777-78104799 CCCTTGGGCCCACTGCACCCACA 0: 1
1: 0
2: 1
3: 19
4: 272
Right 1129757006 15:78104801-78104823 CTTCACATTGTGAAGGAGGCCGG 0: 1
1: 0
2: 3
3: 16
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129757006 Original CRISPR CTTCACATTGTGAAGGAGGC CGG Exonic
900924728 1:5697577-5697599 CTTCACAGAGTGAAGGCGGAAGG - Intergenic
905395178 1:37662197-37662219 CTTCCCATTTCGAAGGAGGTGGG - Intergenic
906318769 1:44804149-44804171 CTTCAAATCCTGAAGGAGACAGG - Exonic
912602864 1:110955889-110955911 ATACACAATGAGAAGGAGGCAGG + Intronic
913202750 1:116509211-116509233 CTTCACATTATGAAGTAGGGTGG + Intergenic
914730750 1:150368126-150368148 CTAAACAATGAGAAGGAGGCAGG - Intronic
917982419 1:180278759-180278781 ATTTACATTGTGAAGGATGAGGG - Exonic
918681365 1:187358521-187358543 CTTCATTTTTTGGAGGAGGCAGG + Intergenic
919991490 1:202710638-202710660 CTTGACCTTGAGCAGGAGGCGGG - Intergenic
921109860 1:212025093-212025115 CTAAACATTGTGAAAAAGGCAGG + Intronic
922666263 1:227471991-227472013 CTTAACATGGTGAAGCAGGAGGG - Intergenic
924080053 1:240386572-240386594 TTTCACATTGCGAAAGAGTCTGG + Intronic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
1066120650 10:32283222-32283244 CTTCACATTGAGGGGGAGGAGGG - Intronic
1067401105 10:45974294-45974316 CTTGAGATTGTGATGGAAGCAGG + Intronic
1067457975 10:46437004-46437026 CTTCACATGGTGGAGCAGGAGGG + Intergenic
1068839100 10:61590290-61590312 TTTCACATTGTGATGGTGGTAGG + Intergenic
1070999742 10:80818229-80818251 CCTGACAGTGTTAAGGAGGCTGG + Intergenic
1071754926 10:88527025-88527047 CTTCTGATTGTAAAGGAGGGAGG - Intronic
1071846884 10:89529842-89529864 CTTAAGACTGTAAAGGAGGCCGG - Intronic
1076490817 10:130860136-130860158 CTTCAGAGGGTGCAGGAGGCTGG - Intergenic
1077279293 11:1734854-1734876 GGTCACATCGTGGAGGAGGCAGG + Exonic
1077303237 11:1856652-1856674 CTCCAGATTCTGAAGGAGGAAGG + Intronic
1077995483 11:7448947-7448969 CTTCACAGAATGAAGGAGGGTGG + Intronic
1078709031 11:13772439-13772461 CTACACACTGTAAAGGAGGCGGG + Intergenic
1082066383 11:47904100-47904122 CTTCACATGGTGGAGGTGGAGGG - Intergenic
1082876312 11:57992475-57992497 CTTCACAGTGTTAAGAAAGCTGG - Intergenic
1083026263 11:59553673-59553695 CTTAACACTGGGAAGTAGGCCGG - Intergenic
1085159028 11:74324025-74324047 CTGTACATTGAGACGGAGGCAGG - Intergenic
1085710013 11:78820757-78820779 CTTCTGAATGTGAAGAAGGCAGG + Intronic
1089019208 11:115194790-115194812 CCTCACATTGGGGAGGAGGGTGG + Intronic
1090351449 11:126110994-126111016 CCTCACATGGTAAGGGAGGCAGG + Intergenic
1091791728 12:3275781-3275803 CTCCACAGTGTGAAGGACCCAGG + Intronic
1093007033 12:14062023-14062045 ATTCCCATTGTAAAGGAGGCAGG + Intergenic
1093315731 12:17647513-17647535 CTTCACATGGTGGAGCAGGAGGG - Intergenic
1095477151 12:42597076-42597098 GTTCACAGTGTGAAGGAGATCGG + Intergenic
1096254764 12:50056298-50056320 CTTAAGATTGTGGAGGAGGGAGG - Intergenic
1097114559 12:56687992-56688014 ACTCACATTGTGAACGGGGCAGG + Exonic
1097236852 12:57546490-57546512 CCTCACCTTGAGAAGCAGGCAGG + Intronic
1099879487 12:88450419-88450441 CTTCACATTGTGAGGGACCCAGG - Intergenic
1100641008 12:96482316-96482338 CTTCATGATGTGAAGAAGGCCGG + Intergenic
1103207473 12:119141509-119141531 ATTCTCAGTGTGATGGAGGCTGG + Intronic
1103824195 12:123723045-123723067 CCTCACCCTGTGAAGTAGGCTGG + Intronic
1105632005 13:22178774-22178796 TTTCACGATGTGAAGGAGTCTGG + Intergenic
1106012607 13:25839453-25839475 CGCCACATTGTGAAGGATCCTGG - Intronic
1106650877 13:31688604-31688626 CCTCACAGTGCTAAGGAGGCTGG + Intergenic
1107098297 13:36560311-36560333 CTGCACAGTGTGAAGGAGGCAGG - Intergenic
1107896301 13:44967233-44967255 CTTCAGAAAGTGAAAGAGGCCGG + Intronic
1108586534 13:51874851-51874873 TTTCAAATTGTGGAGGAGGAGGG - Intergenic
1110042513 13:70781665-70781687 CTACACATTGTGTGGGAGTCAGG + Intergenic
1110541070 13:76707595-76707617 CTTTTTCTTGTGAAGGAGGCTGG + Intergenic
1112412991 13:99179775-99179797 TTTCTCATTGTTAGGGAGGCTGG - Intergenic
1112874789 13:104023954-104023976 CATCACATGGTGAAAGAGGGAGG + Intergenic
1118632123 14:67715112-67715134 CTTCACAAAGTGGAGAAGGCTGG - Intronic
1118823252 14:69358599-69358621 CTTCTCCTTCTGAAGGATGCTGG + Intergenic
1119181360 14:72607384-72607406 CTTCACATGGTGAAGGGGCAAGG + Intergenic
1119868184 14:77991503-77991525 CTTCACATCAAGAAGGAGACTGG - Intergenic
1121097358 14:91226961-91226983 CATGAAATTGAGAAGGAGGCTGG + Intergenic
1122330685 14:100910450-100910472 CCTCACAGTATGAAGAAGGCAGG + Intergenic
1122723990 14:103738729-103738751 CTTCACGATGTGATGGTGGCCGG + Exonic
1122966249 14:105128183-105128205 CTACACATTGTGGAAGAGTCAGG - Intergenic
1124500707 15:30224900-30224922 CTGCACCTTGTGCAGGAGGATGG - Intergenic
1124742863 15:32313767-32313789 CTGCACCTTGTGCAGGAGGATGG + Intergenic
1125770900 15:42165170-42165192 CTTAAAAATGTGAGGGAGGCTGG - Intronic
1126474149 15:49048384-49048406 CTTTCAATTGTGAAGGAGGACGG - Intergenic
1128003053 15:64212008-64212030 CTTGTCATTGTGAAGGAAGAAGG + Intronic
1128114380 15:65096133-65096155 CTTCACCTTCAGAAGGAGGGCGG + Intronic
1128493712 15:68177456-68177478 CTTCAGAATGTGAATGAGGCTGG + Intronic
1128591113 15:68898315-68898337 CTTCACACTGTGAGGGAGTTTGG + Intronic
1128920008 15:71602006-71602028 CTTCACATGATGTAGGAGGTGGG + Intronic
1129757006 15:78104801-78104823 CTTCACATTGTGAAGGAGGCCGG + Exonic
1130921146 15:88345686-88345708 CCTCACATGGTAAAGGAGGAAGG + Intergenic
1131785220 15:95905090-95905112 CTTGGGATTGTGAAGAAGGCTGG - Intergenic
1132211310 15:100024669-100024691 CTTTACATTGTGAAGGGGCAAGG + Intronic
1132311764 15:100862452-100862474 CTGCACACTGGGCAGGAGGCAGG + Intergenic
1134257389 16:12623447-12623469 CTTTACATAGAGAGGGAGGCAGG - Intergenic
1136273735 16:29165522-29165544 CTTCAGAAAGTGAAGGAGGAGGG - Intergenic
1138707057 16:58926268-58926290 CTTCTCCTTGTGAAGGAGCTGGG + Intergenic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1141229362 16:82150351-82150373 CTTCAGATTGAGAAGGAGAGGGG - Intronic
1141762690 16:86039051-86039073 CTTCCCAGTGTGCAGGAGCCTGG + Intergenic
1142077277 16:88127267-88127289 CTTCAGAAAGTGAAGGAGGAGGG - Intergenic
1142260171 16:89039127-89039149 CTCCACCTTGGGAAGGAGGCAGG - Intergenic
1143055979 17:4162103-4162125 TCCAACATTGTGAAGGAGGCCGG + Intronic
1143429762 17:6872503-6872525 CTTCAGATTTTGAAGGAAACTGG + Intergenic
1145839647 17:27983745-27983767 CTGCATATTGAGAAGGGGGCTGG + Intergenic
1146189971 17:30756475-30756497 CAGCACTTTGGGAAGGAGGCAGG - Intergenic
1146334872 17:31960824-31960846 CAGCACTTTGGGAAGGAGGCAGG - Intronic
1149365473 17:55939338-55939360 CCTGACAGTGTTAAGGAGGCTGG + Intergenic
1151099339 17:71538622-71538644 TTCCACATTGTGTAGGAGGCGGG + Intergenic
1152112882 17:78366761-78366783 CTTCACACTGCGGAGGAGGCAGG - Intergenic
1153124436 18:1773654-1773676 CTTCACATTGTCACACAGGCTGG + Intergenic
1153264050 18:3250585-3250607 CTTTACTTTTTCAAGGAGGCTGG - Intronic
1157930419 18:51815602-51815624 CTTCACCTTGTTAGGCAGGCTGG + Intergenic
1157983589 18:52411257-52411279 CTTCACACTGTGAAAGAGCATGG + Intronic
1158659330 18:59371899-59371921 CCTGACATTGCTAAGGAGGCTGG - Intergenic
1159374627 18:67577218-67577240 TTTCAACTTGTGAGGGAGGCTGG - Intergenic
1159591069 18:70335907-70335929 CACGACCTTGTGAAGGAGGCAGG - Intronic
1160725356 19:615807-615829 CTGCACCTTGTGCAGGAGGATGG - Exonic
1162199785 19:9011678-9011700 GTGCCCAGTGTGAAGGAGGCAGG + Intergenic
1163497390 19:17654883-17654905 GCTGACATTGGGAAGGAGGCTGG + Intronic
1164076795 19:21826589-21826611 CAGCACTTTGGGAAGGAGGCAGG + Intronic
1165147310 19:33739262-33739284 CTTCATCTTGTGGAGGAGGGGGG - Intronic
1165817912 19:38654256-38654278 TTTCACTTTCTGGAGGAGGCGGG - Intronic
1168084463 19:54035141-54035163 CTGGACAATTTGAAGGAGGCAGG + Intergenic
925256832 2:2497577-2497599 CTTCTTATTTTGAAGGAGGATGG - Intergenic
927545615 2:23950057-23950079 CTGCACACTGTGAAGGATACAGG + Intronic
928141624 2:28734332-28734354 CTCCACATTATGAAGCAGGATGG + Intergenic
929433720 2:41910334-41910356 GTTCTCACTGTGTAGGAGGCTGG - Intergenic
929539315 2:42808292-42808314 CTGCACCTGGTGAAGGGGGCAGG - Intergenic
930058360 2:47269356-47269378 CTCCACATAGTGAAGGAGGCAGG - Intergenic
931018140 2:58010099-58010121 TTTCTCATTGTAAAGGAGCCAGG - Intronic
931485032 2:62682108-62682130 TTTGACATTCAGAAGGAGGCTGG + Intronic
932823486 2:74920801-74920823 CTGGACATTGAGAGGGAGGCAGG - Intergenic
935608401 2:104994702-104994724 TTTCTCATTGTTAGGGAGGCTGG + Intergenic
935809658 2:106785200-106785222 CCTCACATTGTGGAAGGGGCAGG + Intergenic
935930997 2:108125346-108125368 CTTCAAATTAGGAAGGAGGGAGG + Intergenic
937799811 2:126070444-126070466 CTTCACATTGAGAAGGAGGAAGG - Intergenic
937968205 2:127530609-127530631 CTTCTAATTGTGAGTGAGGCAGG + Intergenic
942398302 2:175575370-175575392 CTTCACATGGAGAGGGAGGGAGG - Intergenic
943162808 2:184277512-184277534 CTGTGCATTGTGAAGGAAGCAGG + Intergenic
943513463 2:188855191-188855213 CTTTACATTTTGAAGGAAGATGG + Intergenic
945576480 2:211536428-211536450 CTTCCCATTGGGGAAGAGGCAGG + Intronic
947135551 2:226973760-226973782 CTTCTGCTAGTGAAGGAGGCAGG - Intronic
948779672 2:240310933-240310955 CACCACATTGAGAAGGAGACTGG - Intergenic
949057201 2:241934611-241934633 CTTCAGACTGTGAAGTTGGCGGG + Intergenic
949066818 2:241996004-241996026 AAGCACATTGAGAAGGAGGCTGG - Intergenic
1169205935 20:3740401-3740423 CTCCACCTTTTGAAGGAGGAGGG + Intronic
1169385612 20:5146841-5146863 CTTCACAGTGTGTAGGATTCAGG + Intronic
1169879368 20:10329521-10329543 CTTGGAATTGTGATGGAGGCGGG + Intergenic
1175385423 20:58591893-58591915 CATGACAATGTGAGGGAGGCAGG + Intergenic
1175443612 20:59006662-59006684 TCTCAGAATGTGAAGGAGGCAGG + Intronic
1176368289 21:6046744-6046766 CTTCACGGTGTGAGGCAGGCTGG + Intergenic
1179391276 21:40994392-40994414 CTTCAAATTGTAAAGGAAACAGG - Intergenic
1179755230 21:43491798-43491820 CTTCACGGTGTGAGGCAGGCTGG - Intergenic
1182500523 22:30743468-30743490 CATCACCCAGTGAAGGAGGCAGG + Intronic
1183060934 22:35335975-35335997 CTTCACACAGGGAAGGGGGCAGG + Intronic
949234836 3:1795623-1795645 TTTCACATTGTGGACGAGACTGG - Intergenic
950472735 3:13196623-13196645 CTTCTCATTGGGAAAGAAGCAGG - Intergenic
950736362 3:15011880-15011902 CATGACATTGGGAAGGAGACAGG - Intronic
951596237 3:24321165-24321187 CTACACATTGAGATGGAGACTGG - Intronic
953993802 3:47504228-47504250 CTTCTTATTGTGCAGGAGGATGG - Intronic
954584588 3:51722257-51722279 CTCAACAATGGGAAGGAGGCAGG + Intergenic
955925680 3:64002299-64002321 CTTAAAACTGTAAAGGAGGCAGG - Exonic
957215842 3:77317971-77317993 CTCCACATTGCGAAGAAGGTGGG + Intronic
957926431 3:86819205-86819227 CTTCACCTTGTGAAGGTGCAAGG + Intergenic
961540159 3:127593950-127593972 CATCACAGTCTGAAGGAGACTGG + Intronic
962938379 3:140102651-140102673 CTTCACATTGTTAATGATACTGG + Intronic
963070925 3:141304540-141304562 CTCAACACTGTGAAGGATGCTGG - Intergenic
963839835 3:150093968-150093990 CTAAACTTTGTGAATGAGGCTGG + Intergenic
963982532 3:151555737-151555759 CTGCACATTGTTACAGAGGCAGG - Intergenic
964431742 3:156614355-156614377 CTTCATAATAGGAAGGAGGCTGG + Intergenic
965460617 3:168957547-168957569 CTTCACATTGTGAAAGACTAAGG + Intergenic
967387458 3:188925699-188925721 CTTCACAGTGTGTGGGAGGTGGG + Intergenic
969713270 4:8856670-8856692 CTTCCCATTTTGAAGAAGGAGGG + Intronic
969904069 4:10376865-10376887 CTTCTCAGTGTGAAGGATGAGGG - Intergenic
970943441 4:21662131-21662153 CTTCAGATTGTGGAGGACACAGG - Intronic
971734459 4:30428297-30428319 ACTCACATGATGAAGGAGGCTGG - Intergenic
971810325 4:31416917-31416939 CTTCACATTCTCAAGGATGAAGG - Intergenic
979162042 4:117473666-117473688 CTGCACATTGTCATGGAGTCAGG + Intergenic
980423767 4:132598226-132598248 CTACAAATTGTAAATGAGGCTGG - Intergenic
985184730 4:187303628-187303650 CGTCAATTTGTGAAGGAGGCCGG + Intergenic
988465382 5:31485864-31485886 CTTAACATTGTGTTGGAGTCAGG - Intronic
991306494 5:65181880-65181902 TTTTAAAATGTGAAGGAGGCAGG - Intronic
994408033 5:99370493-99370515 CTACACAGTGTGAAGGAAGCAGG - Intergenic
994554349 5:101279100-101279122 CTGTACATTGTGTAGGAGGTTGG - Intergenic
996203158 5:120700472-120700494 CTTTAGATTGTGAAGAAGGGTGG + Intergenic
997311377 5:132886471-132886493 CTTTGCATTGTGCAGGAGACTGG + Intronic
997849445 5:137317728-137317750 CTTCACATTCTGGAGGAAGGAGG - Intronic
998439458 5:142144903-142144925 TTTGACAGTGTGAAAGAGGCAGG + Intronic
1000485253 5:161833699-161833721 CTTCTCATAGTGAAAGAGGTGGG - Intergenic
1003459915 6:6320134-6320156 CTCCAAATTGGGACGGAGGCAGG + Intronic
1003941484 6:11032186-11032208 CTTAACCTTGTGCAGGAGCCAGG - Intronic
1005492400 6:26358973-26358995 CCTCACATTGTGAGGGGGCCTGG + Intergenic
1006114720 6:31769437-31769459 CTTCACATTGTTTATTAGGCAGG + Intronic
1006907594 6:37543484-37543506 CTTCAAAATGTGCAGAAGGCTGG - Intergenic
1008252491 6:49257399-49257421 CTTCACTTCTTGAAGAAGGCAGG + Intergenic
1012433094 6:99186667-99186689 GAACACAATGTGAAGGAGGCAGG + Intergenic
1012872031 6:104683861-104683883 CTTCACAGTGTGAAGAATCCAGG + Intergenic
1015375050 6:132500901-132500923 TTTCACCTTGAGAAGGAGGAAGG - Intronic
1015979240 6:138822253-138822275 CATTACATGGGGAAGGAGGCCGG + Intronic
1017491673 6:154950937-154950959 CTTCACACTCTGGAGGAAGCTGG - Intronic
1018407844 6:163506068-163506090 CTTCACAAGGTGATGGAGGCGGG - Intronic
1018984353 6:168625060-168625082 CTTCACAGTGTCCAGGGGGCAGG - Intronic
1022166232 7:27765530-27765552 CTTTACAATGGGAAAGAGGCTGG - Intronic
1023115709 7:36859962-36859984 CTTCACATTGAGTAGGATGAGGG - Intronic
1024324955 7:48102215-48102237 CTACACAGTGTGAGGGTGGCAGG + Intronic
1024706958 7:51971625-51971647 CTACCCATTGTAAGGGAGGCTGG - Intergenic
1026086112 7:67264605-67264627 CTTCACATAGTGAAGTACCCAGG + Intergenic
1026691044 7:72550204-72550226 CTTCACATAGTGAAGTACCCAGG - Intergenic
1026942392 7:74294699-74294721 CTGCACATTGTGAGGTGGGCAGG - Intronic
1029732319 7:102446634-102446656 CTCCACATTGGGCAGGATGCAGG - Exonic
1030618958 7:111769013-111769035 CTTCACATGGTGAAAGGGGCTGG - Intronic
1032271177 7:130408087-130408109 CTTCCCTTGGGGAAGGAGGCAGG - Intronic
1033004396 7:137545894-137545916 ACTCACATGGTGAAGGAGCCGGG + Intronic
1034949835 7:155289838-155289860 CCTCACATGGTGAAGGGGCCAGG + Intergenic
1034951807 7:155303167-155303189 CTTCCGATGGTGAAGGAGGAGGG - Intronic
1039162356 8:34636681-34636703 CTAAACATTGTGAAAGAGGATGG - Intergenic
1039562261 8:38522139-38522161 CTTCTCAATGCTAAGGAGGCTGG - Intronic
1039759129 8:40555749-40555771 ATTCATCTAGTGAAGGAGGCTGG - Intronic
1040300245 8:46184250-46184272 CTTCAGATTTTGAAGCAGGGTGG - Intergenic
1040491397 8:47925411-47925433 CTTGACATTTTGAAGGCTGCAGG - Intronic
1041639133 8:60178073-60178095 CATTACATTGTAAAGAAGGCTGG + Intergenic
1044770937 8:95633249-95633271 CTGTACATTGTGAAGGAGACAGG - Intergenic
1044781702 8:95750218-95750240 CTGCACATAATGCAGGAGGCTGG - Intergenic
1044937341 8:97305848-97305870 CTTCACATCATGAAGGATGAGGG + Intergenic
1045116380 8:98986906-98986928 TTTCACTTGGTGAAGGAGTCAGG + Intergenic
1048544117 8:135370173-135370195 CTTCACATTCTGAAGAAGAATGG + Intergenic
1050301094 9:4259677-4259699 CTTAACCTAGCGAAGGAGGCAGG + Intronic
1050450234 9:5772899-5772921 CTACACATTTTCATGGAGGCAGG + Exonic
1051847595 9:21469642-21469664 TTTCACAGTGAAAAGGAGGCAGG - Intergenic
1055114792 9:72594824-72594846 CTGCACATTGTGAGGCAGGCAGG - Intronic
1056818053 9:89815989-89816011 CTTCTCACAGTGCAGGAGGCCGG - Intergenic
1057126647 9:92621057-92621079 CTTCACATGGTGAAAGGGGCTGG + Intronic
1058948646 9:109882384-109882406 CTAAACATTGTGAAGGAAACTGG + Intronic
1059368066 9:113802237-113802259 TTTCACATTGTTAAGAAGGCAGG + Intergenic
1188831368 X:34902007-34902029 CTTCACATTATGAATGATGTAGG + Intergenic
1195233890 X:102878088-102878110 CTTCACATTGAGGAAGAGGATGG - Intergenic
1195350276 X:103989093-103989115 CTTAACATACTGGAGGAGGCTGG + Intergenic
1198506606 X:137307617-137307639 CTACATATTGTGCAGGATGCTGG - Intergenic