ID: 1129760510

View in Genome Browser
Species Human (GRCh38)
Location 15:78126572-78126594
Sequence GACGCAGGACATGGAGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 177}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129760510_1129760517 29 Left 1129760510 15:78126572-78126594 CCAGCCACTCCATGTCCTGCGTC 0: 1
1: 0
2: 0
3: 20
4: 177
Right 1129760517 15:78126624-78126646 AGGTGCTTAATACAGGCTTGTGG 0: 1
1: 0
2: 3
3: 35
4: 263
1129760510_1129760518 30 Left 1129760510 15:78126572-78126594 CCAGCCACTCCATGTCCTGCGTC 0: 1
1: 0
2: 0
3: 20
4: 177
Right 1129760518 15:78126625-78126647 GGTGCTTAATACAGGCTTGTGGG 0: 1
1: 0
2: 2
3: 21
4: 216
1129760510_1129760514 9 Left 1129760510 15:78126572-78126594 CCAGCCACTCCATGTCCTGCGTC 0: 1
1: 0
2: 0
3: 20
4: 177
Right 1129760514 15:78126604-78126626 TTCCTATACTTATACACAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 138
1129760510_1129760516 22 Left 1129760510 15:78126572-78126594 CCAGCCACTCCATGTCCTGCGTC 0: 1
1: 0
2: 0
3: 20
4: 177
Right 1129760516 15:78126617-78126639 ACACAGCAGGTGCTTAATACAGG 0: 1
1: 0
2: 10
3: 63
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129760510 Original CRISPR GACGCAGGACATGGAGTGGC TGG (reversed) Intronic
900759605 1:4462037-4462059 GAGGCAGGCCAAGGACTGGCAGG - Intergenic
902152220 1:14452586-14452608 GAGGCAGGACCTTGAGTGGCAGG + Intergenic
904259507 1:29280253-29280275 CACGCAGGGCTTGGAGTGTCTGG + Intronic
905453380 1:38071315-38071337 GACCCAGGGCCTGGAGCGGCTGG + Intergenic
906539163 1:46571956-46571978 GGTGCAGGAGATGGTGTGGCTGG - Intronic
907110633 1:51923343-51923365 GATGCAGGAGAGGGAGAGGCTGG + Intronic
907571003 1:55483756-55483778 GACGGATGAGATGGAGTGCCTGG + Intergenic
910118372 1:83757510-83757532 GGTACAGGGCATGGAGTGGCGGG - Intergenic
910423919 1:87100357-87100379 GAGGCTGGAACTGGAGTGGCCGG + Intronic
912381113 1:109248786-109248808 GCCGCAGGACATGGACAGGGAGG + Intergenic
913334684 1:117698362-117698384 GAGGGAGGGCCTGGAGTGGCAGG + Intergenic
916397352 1:164405570-164405592 GAGTCAGGACTTGGAGTTGCGGG - Intergenic
916574873 1:166058370-166058392 GACGCTGGAGAGGGAATGGCTGG + Intronic
917871142 1:179243083-179243105 GATGCAGGACATGGAGTCAAAGG + Intergenic
918098574 1:181354362-181354384 GGCTGAGGACAAGGAGTGGCAGG + Intergenic
922194167 1:223345496-223345518 GATGCAGGAGAGGGAGCGGCAGG - Intronic
922421210 1:225462214-225462236 GAGGCAGGCCATGGGGTGGCAGG - Intergenic
923630885 1:235649241-235649263 GTGGCAGGAGATGGCGTGGCTGG - Intronic
924006821 1:239621286-239621308 GACTCAGGAAATGGGGTGGAGGG - Intronic
924739264 1:246785489-246785511 GGTGCAGGACAGGGAATGGCTGG + Intergenic
924903367 1:248426123-248426145 AAAGCAGGACATGAAGTGGAAGG - Intergenic
924924497 1:248665681-248665703 AAAGCAGGACATGAAGTGGAAGG + Intergenic
1062787472 10:277697-277719 GACGGAGGACGTGGAGAGGCCGG - Intronic
1065989521 10:30993882-30993904 GATGCAGGACATGGAGTCAAAGG + Intronic
1067787935 10:49264506-49264528 GAGGCAGGAGATGGATGGGCCGG - Intergenic
1069750309 10:70741181-70741203 GCCTAAGGACATGGAGTGGGAGG - Intronic
1070384978 10:75916301-75916323 CAGGCAGGACATGCAGTGCCTGG + Intronic
1073493988 10:103874765-103874787 GACCAAGCACTTGGAGTGGCAGG + Intergenic
1076092531 10:127700225-127700247 GAAGCAGGACAGTGGGTGGCTGG - Intergenic
1076403247 10:130196812-130196834 CCCGCAGGTCATGGGGTGGCAGG - Intergenic
1077021717 11:419993-420015 AACCCAGGAGGTGGAGTGGCTGG - Intronic
1077174020 11:1180688-1180710 GACTCAGGACATGGGGGTGCTGG - Intronic
1082741516 11:56916695-56916717 GACACCGGAAATGGAGAGGCCGG + Intergenic
1084033565 11:66494772-66494794 GACGCATGGCATGCAGTGGGAGG + Intronic
1084038702 11:66529470-66529492 GTGGCAGGACATGGATTGTCTGG + Intronic
1084169151 11:67392173-67392195 GATGCGGGACAGGGAGTGGACGG - Exonic
1088773263 11:113057068-113057090 GATGCTGGAGATGTAGTGGCAGG + Intronic
1089299083 11:117487683-117487705 GACGAAGGACATTGACAGGCTGG + Intronic
1089456486 11:118628629-118628651 GGAGCAGGAGATGGAGAGGCTGG + Exonic
1091435042 12:465753-465775 CTCCCAGGACAGGGAGTGGCAGG - Intronic
1091435059 12:465814-465836 CTCCCAGGACAGGGAGTGGCAGG - Intronic
1091435077 12:465875-465897 CCCCCAGGACAGGGAGTGGCAGG - Intronic
1091435112 12:465999-466021 CTCCCAGGACAGGGAGTGGCAGG - Intronic
1091435129 12:466060-466082 CTCCCAGGACAGGGAGTGGCAGG - Intronic
1091435146 12:466121-466143 CTCCCAGGACAGGGAGTGGCAGG - Intronic
1093186143 12:16021687-16021709 GATGCAGGACATGGAGTCAAAGG + Intronic
1093934119 12:24983226-24983248 GATGCAGGACATGGAGTCAAAGG - Intergenic
1096638535 12:52976344-52976366 GATGCAGGACATGGAAGGGTGGG - Intergenic
1099391024 12:82078548-82078570 GAGGCAGCCCATGGCGTGGCTGG - Intergenic
1101834315 12:108284638-108284660 TACCCAGGACAGGTAGTGGCAGG - Intergenic
1106032162 13:26013243-26013265 GCCGCAGGACACAGAGAGGCAGG - Intronic
1106852725 13:33812536-33812558 GAAGGAGGAGATGGGGTGGCAGG - Intergenic
1108855835 13:54791586-54791608 GATGCAGGACATGGAGTCAGTGG - Intergenic
1113894935 13:113758662-113758684 GACGCAGGCCTTGGAGAGGCGGG + Intergenic
1116439791 14:44938704-44938726 GAAGTAGGACATGGAGTCGAAGG - Intronic
1121113335 14:91327447-91327469 AAGGCAGGACATGGATTGCCTGG - Intronic
1123506133 15:20942243-20942265 CACGCTGGACACGGAGTGGCGGG + Intergenic
1123563361 15:21515950-21515972 CACGCTGGACACGGAGTGGCGGG + Intergenic
1123599612 15:21953233-21953255 CACGCTGGACACGGAGTGGCGGG + Intergenic
1123996061 15:25718750-25718772 GAGGCAGGACAGAGGGTGGCAGG + Intronic
1124037744 15:26071706-26071728 GAAGCAGGACAAGCAGGGGCTGG + Intergenic
1126353001 15:47764576-47764598 GATACAGTACATGGTGTGGCAGG + Intronic
1127621026 15:60734618-60734640 CACGCAGGACATGGAGAGGTCGG - Intronic
1128223053 15:65982210-65982232 GCGGCAGGACCTGGAGGGGCGGG - Intronic
1128639353 15:69324734-69324756 TACGCAGGGTATGGAGTGGCAGG - Intronic
1129760510 15:78126572-78126594 GACGCAGGACATGGAGTGGCTGG - Intronic
1129908280 15:79205278-79205300 GACTCAGGACAGGGAGAGGGAGG - Intergenic
1202971717 15_KI270727v1_random:243084-243106 CACGCTGGACACGGAGTGGCGGG + Intergenic
1135136240 16:19886766-19886788 GAAGGAGGACATTGAGTGGCAGG + Intergenic
1137583808 16:49651788-49651810 GTCACAGGACAAGGAGAGGCTGG + Intronic
1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG + Exonic
1139133931 16:64178730-64178752 GACGCAAGACATGGAGTCAAAGG + Intergenic
1139681714 16:68570090-68570112 GATGCAAGAAATGGAGTGGTAGG - Intronic
1140953357 16:79839874-79839896 GAGGCCGGACAAGGAGTGGGAGG - Intergenic
1140954036 16:79846021-79846043 GACTCAGGACTTGGGGTAGCAGG + Intergenic
1141485754 16:84339300-84339322 GACACAGTACATGGAGAAGCAGG + Intergenic
1142263681 16:89053959-89053981 GACCCAGCGCATGGAGGGGCAGG - Intergenic
1143411541 17:6712496-6712518 GTGGCAGGACCTGGAGTTGCAGG - Intronic
1143756128 17:9068895-9068917 GATGCAGGAAAGAGAGTGGCTGG + Intronic
1145871501 17:28277185-28277207 GAAGCAGGACATGGAGATCCGGG + Intergenic
1146591259 17:34129887-34129909 GAGGCAGGACATGGTATGTCTGG - Intronic
1147000942 17:37361432-37361454 AAAGCAGGACATGCAGGGGCTGG - Intronic
1152082619 17:78197771-78197793 GACCCAGGACAAGCAGTGGAGGG + Intronic
1152275694 17:79355474-79355496 GCAGCAGGACCTGGAGAGGCTGG - Intronic
1152375223 17:79915421-79915443 GAGGCAGCACAAGGAGGGGCTGG + Intergenic
1155205300 18:23553128-23553150 GAAGCGGTACAGGGAGTGGCAGG - Intronic
1157238998 18:45992000-45992022 GAAACAGGACATGAAGAGGCAGG + Intronic
1157519387 18:48334894-48334916 GACTTGGGACCTGGAGTGGCTGG + Intronic
1160134351 18:76259886-76259908 GGCGGAGGTCATGGAGGGGCCGG + Exonic
1160457109 18:79009108-79009130 GACACAGGCCAGGGAGTGGCGGG - Intergenic
1161768429 19:6219063-6219085 GACTCAGGACCTTGAGTGCCTGG + Intronic
1161777518 19:6271781-6271803 GACTCAGGCCATGGTCTGGCTGG - Intronic
1163056732 19:14725703-14725725 GACGCAGGACATGGAGTCAAAGG - Intronic
1163509539 19:17726764-17726786 GCCCCAGGACCTGGAGGGGCCGG + Exonic
1164756069 19:30690678-30690700 GACGCAGGAAATGGGGCAGCTGG - Intronic
1164850864 19:31483120-31483142 GATGCAGGACATGGAGTCAAAGG - Intergenic
1165054554 19:33166146-33166168 GTAGCTGGACCTGGAGTGGCTGG - Intronic
1166098440 19:40556059-40556081 GAAGGGGGACATGGAGGGGCAGG - Intronic
1167272166 19:48511703-48511725 GACGCAGGACAGGGGGAGGGAGG + Intronic
1168581631 19:57559882-57559904 GGCGCAGGAAAAGGCGTGGCAGG - Intergenic
927843818 2:26461279-26461301 GATGCATGGCAGGGAGTGGCAGG - Intronic
929619617 2:43341531-43341553 GATGGAGGAGATGGAGCGGCAGG - Intronic
929947887 2:46384010-46384032 GAGGCAGACCAGGGAGTGGCAGG - Intronic
931858481 2:66329126-66329148 GAAGGATGACATGGAGAGGCCGG + Intergenic
937335985 2:121062625-121062647 GACGCATGAAATGGAGAAGCCGG - Intergenic
937615823 2:123921187-123921209 GAAGCAGTACATGAAGTGGTGGG - Intergenic
937937826 2:127260172-127260194 GAGTCATGACGTGGAGTGGCTGG - Intronic
938130044 2:128707409-128707431 GATGCAGGACATGGAGTCAAAGG - Intergenic
938389761 2:130895497-130895519 GAGGCAGGACACAGAGTGACTGG - Intronic
945127007 2:206523497-206523519 GATCGAGGACATGGAGAGGCTGG - Intronic
947525434 2:230874377-230874399 GACGCAGGCCATGGAGGGAGTGG - Intronic
948627019 2:239275663-239275685 GAGGCTGGACCTGGAGTCGCAGG - Intronic
948795451 2:240400077-240400099 GGCGCAGGACAGGGAAGGGCGGG + Intergenic
1168745276 20:233852-233874 GTGGCAGGACCTGGAGTGGCAGG - Intergenic
1168810836 20:703603-703625 GGAGCAGGACATGGAGAGGATGG - Intergenic
1172504962 20:35455066-35455088 GGTGCAGGACTTGGAGGGGCGGG + Intergenic
1173660403 20:44729323-44729345 GATGCAGGACAAGGAAGGGCAGG + Intergenic
1175280884 20:57803449-57803471 GAGGCAGGACATGAGCTGGCGGG + Intergenic
1175948601 20:62570318-62570340 GAAGCAGGAGACGGAGTGGCCGG - Intronic
1176258870 20:64168582-64168604 GCTGCAGGACAAGGGGTGGCAGG - Intronic
1178477066 21:32946337-32946359 GAAGCAGGACACGGAGAGGGAGG + Intergenic
1179380877 21:40897853-40897875 GATGCAGGACGTGGAGTTGAAGG + Intergenic
1181392428 22:22593460-22593482 GAGGCAGGGCAGGGAGGGGCTGG + Intergenic
1183171935 22:36194718-36194740 GACCCAGGACACAGAGAGGCTGG - Intronic
1183178867 22:36245144-36245166 GGCCCAGGACATGGAGAGGCTGG + Intergenic
1185027606 22:48424660-48424682 GAGGCAGGATAGGGAGTGGTGGG + Intergenic
952744208 3:36762631-36762653 GACTCAGAACAGGGAGTGCCTGG - Intergenic
953060670 3:39426476-39426498 GACACAGGACTGGGACTGGCAGG + Intergenic
953202236 3:40787771-40787793 GATGCAGGACATGGAGTCAAAGG + Intergenic
958059781 3:88464960-88464982 GCTGCAGCACATGTAGTGGCTGG + Intergenic
958468096 3:94483277-94483299 GACCCAGGGCAGGGAGTGCCAGG + Intergenic
960950389 3:122995166-122995188 GAAGCAGGACATCGGGTGGTGGG + Intronic
961316376 3:126038466-126038488 AACGCAGGACATGGAGTCAAGGG + Intronic
962710081 3:138078836-138078858 AAAGCAGAACATGGAGTGGGTGG - Intronic
968541143 4:1169031-1169053 GAGGCAGGACATGGAGAGAAGGG - Intronic
969866258 4:10078715-10078737 GTGGCAGGAGATGGCGTGGCTGG + Intronic
972537049 4:40008503-40008525 GAGGCATGCCATGGAGAGGCTGG - Intergenic
977874209 4:102129764-102129786 GATGCATGACATGGAGTTGAAGG + Intergenic
980181425 4:129406229-129406251 TACACAGGAGATGGAGTGGGAGG + Intergenic
985543903 5:499825-499847 GACCCTGGACTGGGAGTGGCTGG - Intronic
986304082 5:6502644-6502666 GCTGCAGGTCATGGAGCGGCCGG + Intergenic
988641606 5:33046652-33046674 GTCGAGGGACATGGAGTGGAGGG + Intergenic
988980924 5:36568418-36568440 TATTCAGGCCATGGAGTGGCAGG - Intergenic
989261379 5:39423412-39423434 GACACAGAACCTGGAGTGGGCGG + Intronic
997386862 5:133480533-133480555 TAACCAGGACAAGGAGTGGCTGG - Intronic
1001835469 5:174827618-174827640 GATGCAGGAACTGGAGTGGAGGG - Intergenic
1002009241 5:176264041-176264063 GATGCAGGACATGGAGTTAAGGG - Intronic
1002217480 5:177648242-177648264 GATGCAGGACATGGAGTTAAGGG + Intergenic
1004188807 6:13446504-13446526 GACACAGGACATGGTGAAGCCGG + Intronic
1006339886 6:33441000-33441022 GTGGCAGGGCAGGGAGTGGCAGG + Intronic
1007048249 6:38799110-38799132 TTGGCAGGACATGGAGTGTCTGG + Intronic
1010061435 6:71627005-71627027 GGCACAGGACATGGAAGGGCTGG - Intergenic
1011529325 6:88302778-88302800 GAGGCAGGAGATGGAGGGGTAGG + Intergenic
1014599719 6:123395593-123395615 GACGCGGGACAATGAGGGGCAGG - Intronic
1016739578 6:147513138-147513160 GTGGCAGGAGATGGAGAGGCAGG + Intronic
1017658277 6:156650244-156650266 GACTCAGGACACGGAGAAGCTGG - Intergenic
1018554643 6:165036813-165036835 GACGCAAGACATGGAGTCAAAGG + Intergenic
1019063416 6:169275002-169275024 GAGGCTGGAGCTGGAGTGGCTGG - Intergenic
1019338262 7:495178-495200 GTCGCAGGACACAGAGAGGCAGG - Intergenic
1019415164 7:923703-923725 GCCGCAGGGCATGGCGTGGGGGG + Intronic
1019541522 7:1553818-1553840 CAGGCAGGACACAGAGTGGCTGG - Intronic
1019697001 7:2451637-2451659 CACGCAGGGCATGGGGTGGCCGG + Intergenic
1024318933 7:48046102-48046124 GACGCAGGGCCTGGAGGGGTTGG + Intronic
1026176067 7:67998077-67998099 GAAGGAGGCCATGGACTGGCAGG + Intergenic
1034344699 7:150379225-150379247 GGCGCAGCCAATGGAGTGGCTGG + Intronic
1034967126 7:155398429-155398451 GACTCCGCACTTGGAGTGGCTGG - Intergenic
1036136506 8:6166611-6166633 GACACAGGACCTGCAGTGACTGG + Intergenic
1039965265 8:42279369-42279391 GATGCAGTGCATGGAGTGTCAGG - Intronic
1040079822 8:43275061-43275083 GAAGCAGGAGAAGGAGTGGGAGG - Intergenic
1041552022 8:59113705-59113727 GTCCCAGGAGTTGGAGTGGCTGG + Intronic
1042252867 8:66774410-66774432 GACTCAGCCCATGGAGTAGCTGG + Intronic
1042794531 8:72646689-72646711 GAGGCAGAACATAGAATGGCGGG + Intronic
1044623386 8:94212838-94212860 TACGCATGCCATGAAGTGGCTGG + Intronic
1045012120 8:97967611-97967633 GATGCAGGACATGGAGTCAAAGG - Intronic
1045597503 8:103673084-103673106 CACGCAGGACATGGAGTCAAAGG - Intronic
1047772542 8:128041951-128041973 GACACAGGAGAAGGAATGGCTGG - Intergenic
1048173603 8:132131495-132131517 GACACACAACATGCAGTGGCAGG + Intronic
1048648708 8:136450991-136451013 GAGTCAGGCCATGCAGTGGCTGG + Intergenic
1049505442 8:142994068-142994090 GAGGCAGGCCCTGGAGTGGTGGG + Intergenic
1050057574 9:1671932-1671954 GATGCAGGACATGGAGTTGTAGG - Intergenic
1050087470 9:1980891-1980913 GAGGCAGGGCAGGGAGTGTCAGG - Intergenic
1052314044 9:27097725-27097747 GATGCAGGACTTGGAGTCACAGG + Intergenic
1055267595 9:74515360-74515382 GACTCAGGAGATAGAGTGCCTGG - Intronic
1055516358 9:77037476-77037498 GTTGCAGGACATGGAATGGAAGG - Intergenic
1059917278 9:119117814-119117836 AAGGCTGGACCTGGAGTGGCTGG - Intergenic
1060103226 9:120857779-120857801 GACGCAGGCCTTGGCCTGGCAGG + Exonic
1061582297 9:131545619-131545641 GAGGCAGGAGCTGGAGGGGCAGG + Intergenic
1062153631 9:135034043-135034065 GAGGCAGGGGATGGGGTGGCGGG - Intergenic
1062153699 9:135034232-135034254 GAGGCAGGGGATGGGGTGGCGGG - Intergenic
1062185384 9:135215532-135215554 GAGGCAGGCCAGGGAGCGGCAGG + Intergenic
1189698717 X:43694089-43694111 GAAGCCAAACATGGAGTGGCTGG + Intronic
1193225000 X:78972045-78972067 GACGCTGGAGCTGGAATGGCTGG + Intergenic
1194471625 X:94304484-94304506 GATGCAGGACATGGAGTCAAAGG - Intergenic
1198536452 X:137591297-137591319 GAAGCTGGACATGGAATTGCAGG + Intergenic
1200003997 X:153075554-153075576 AACCCAGGACAAGGAGTGGGGGG + Intergenic
1200876011 Y:8155422-8155444 GACCCAGGACATGGAGATGCAGG - Intergenic
1202102973 Y:21329926-21329948 GACCCAGGACATGGAGATGCAGG - Intergenic
1202189264 Y:22224069-22224091 GACCCAGGATATGGAGATGCAGG - Intergenic