ID: 1129760754

View in Genome Browser
Species Human (GRCh38)
Location 15:78128125-78128147
Sequence CTGTGGCCACACAAGGGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 327}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129760748_1129760754 -7 Left 1129760748 15:78128109-78128131 CCCAGTATAAACCATTCTGTGGC 0: 1
1: 0
2: 1
3: 16
4: 115
Right 1129760754 15:78128125-78128147 CTGTGGCCACACAAGGGACTGGG 0: 1
1: 0
2: 0
3: 20
4: 327
1129760749_1129760754 -8 Left 1129760749 15:78128110-78128132 CCAGTATAAACCATTCTGTGGCC 0: 1
1: 0
2: 0
3: 4
4: 89
Right 1129760754 15:78128125-78128147 CTGTGGCCACACAAGGGACTGGG 0: 1
1: 0
2: 0
3: 20
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129760754 Original CRISPR CTGTGGCCACACAAGGGACT GGG Intronic
900293940 1:1939312-1939334 CTGGGGCCACACAAGGTAGCTGG - Intronic
900995442 1:6121056-6121078 CTGAGGCCAGACATGGCACTGGG + Intronic
902376626 1:16032983-16033005 CAGAGGCCACTCAAGGGTCTGGG - Intronic
902667691 1:17951168-17951190 CTGTGCAGGCACAAGGGACTTGG - Intergenic
902957284 1:19934215-19934237 CTGTGGGCACCCAAAGGCCTGGG + Intergenic
903339604 1:22645337-22645359 CTGAGACCACACCTGGGACTTGG - Intronic
904863860 1:33561152-33561174 ATCTGGCCACACCAAGGACTGGG - Intronic
905918715 1:41704501-41704523 CTGTAGCCACCACAGGGACTGGG - Intronic
906153376 1:43600515-43600537 CTGTGGCCACGCTCGGGACCAGG - Intronic
907021056 1:51067119-51067141 CTGTGTGCACCCTAGGGACTTGG - Intergenic
907038676 1:51238245-51238267 CAGTGGGGACACAAGGGATTCGG - Intronic
907271928 1:53296367-53296389 CTGGGTGCACAGAAGGGACTTGG + Intronic
907913525 1:58847919-58847941 CTGTGGACCCAAAAGGGTCTGGG - Intergenic
909808837 1:79905916-79905938 CTGTGGGCAGCCTAGGGACTTGG - Intergenic
912857055 1:113178488-113178510 CTCTGGCCACCCAAGGGAGGTGG + Intergenic
915313305 1:155015314-155015336 CTGTGGGCACCTCAGGGACTAGG - Exonic
916945999 1:169728082-169728104 ATGTGGCCCCACAGGGGAGTGGG - Exonic
917082616 1:171272086-171272108 CTGTGTGCAGCCAAGGGACTTGG + Intronic
920051977 1:203169786-203169808 CTTGGGGCACACAAGGGACAGGG + Intronic
920501503 1:206488231-206488253 CTGTTGCCACATGAGAGACTTGG + Intronic
921773534 1:219071433-219071455 CTGTGTGCACCCTAGGGACTTGG + Intergenic
921926032 1:220710702-220710724 CTCTGGCCTCCCAAGGCACTGGG - Intergenic
923064310 1:230504111-230504133 CTATGGCCACACAGGAAACTGGG - Intergenic
923167582 1:231381155-231381177 CTCTGGCCTCACAAAGTACTGGG + Intronic
924614222 1:245599379-245599401 CTTTGGCCAGACCAGCGACTGGG + Intronic
1062911238 10:1213799-1213821 CAGTGGCCACTCAAGGGGCAGGG - Intronic
1064071180 10:12229333-12229355 GTGTGCCCACCCAGGGGACTTGG - Intronic
1064220449 10:13436243-13436265 CTTTGGCCTCTCAAGGCACTGGG + Intergenic
1064791670 10:18963251-18963273 CTGAGCCCACACAAGGAAATAGG + Intergenic
1064904058 10:20326022-20326044 CTGTGGCCACACATGTCCCTAGG + Intergenic
1065451248 10:25860210-25860232 CTGTGGCCTCCCAAAGTACTGGG - Intergenic
1066191646 10:33061399-33061421 CTGTGGCCTCCCAAAGTACTGGG + Intergenic
1067911422 10:50350579-50350601 CTGTGTGCAGACTAGGGACTTGG + Intronic
1068519499 10:58062998-58063020 CTGTGTGCACCCTAGGGACTCGG - Intergenic
1069166441 10:65166481-65166503 CTGTGCACATCCAAGGGACTTGG - Intergenic
1070310547 10:75270487-75270509 CTTTGGCCTCCCAAGGCACTGGG + Intergenic
1071130835 10:82391601-82391623 CTGTGACCACACATGGGAAGGGG - Intronic
1071979381 10:90988162-90988184 CTGTGGCCACACTATGGCATTGG + Intergenic
1072419889 10:95281326-95281348 CTGTGGCCTCCCAAAGTACTGGG - Intronic
1072921401 10:99579994-99580016 ATGAGGCCAGACAAGGGCCTGGG + Intergenic
1073035847 10:100563729-100563751 CTGTCTCCACACCAGGTACTGGG - Intergenic
1074640218 10:115370942-115370964 CTGTGTCCAGTCTAGGGACTTGG + Intronic
1075089411 10:119435088-119435110 CTGTGTGCAGCCAAGGGACTTGG - Intronic
1075780780 10:125015897-125015919 GTGTGGACACACACGGGGCTGGG + Intronic
1076163104 10:128261192-128261214 CTGTGGCCACACAATAAACGTGG + Intergenic
1076737742 10:132466259-132466281 CTGTGGCCACAGGAGGGGCCCGG - Intergenic
1076926840 10:133495040-133495062 CTGTGTACAGCCAAGGGACTTGG - Intergenic
1078104607 11:8350838-8350860 CTGTAGCCACGGAAGTGACTGGG + Intergenic
1078533407 11:12154285-12154307 GTGTAGCCACACAAGGGCCCAGG + Intronic
1078550848 11:12279718-12279740 CTGTCTCCACACATGGAACTCGG + Intronic
1087153450 11:94879171-94879193 CTGTGGCTTCACAAGGTACCTGG - Intergenic
1087550061 11:99638111-99638133 CTGAGGCCTCACAAGGTACGTGG - Intronic
1088435261 11:109805073-109805095 CTGTGTGCAGCCAAGGGACTTGG - Intergenic
1088635110 11:111812315-111812337 CTTTGGCCTCCCAAGGTACTAGG - Intronic
1089546812 11:119233482-119233504 CTTTGGCCTCACAAGGTGCTGGG + Intronic
1089652551 11:119923835-119923857 ATGTGGCCATACACTGGACTGGG + Intergenic
1089696378 11:120218670-120218692 CTAGGGCCACACAAGCCACTTGG - Intronic
1090704742 11:129326103-129326125 CTGTGGTCAAACAGGGGACTAGG - Intergenic
1091769958 12:3145103-3145125 CTGTGTGCTCACAAGGGAGTGGG - Intronic
1093176299 12:15916860-15916882 CTGTGGCCTCCCAAGTGGCTGGG + Intronic
1093941872 12:25064048-25064070 CTGTGGCCTCCCAAGGTGCTGGG - Intronic
1093955042 12:25207190-25207212 CAGTCACCACACAAGGCACTGGG - Intronic
1094206350 12:27844499-27844521 CTGTAGTCAAACAAGGGATTCGG - Intergenic
1094762555 12:33551245-33551267 CTGTGTGCACTCTAGGGACTTGG + Intergenic
1097170840 12:57111682-57111704 GTTTGGACCCACAAGGGACTGGG + Intronic
1097798249 12:63886310-63886332 CTTTGGCCTCTCAAGGTACTGGG + Intronic
1098251814 12:68577889-68577911 CTTTGGCCACCCAAAGCACTGGG - Intergenic
1099260040 12:80367223-80367245 CTTTGGCCTCACAAAGTACTGGG + Intronic
1099627168 12:85090002-85090024 CTGTGGCCACACAGGGCAGTGGG - Intronic
1102160977 12:110768559-110768581 CTGTGGCCTCCCAAAGTACTGGG + Intergenic
1102565738 12:113796392-113796414 CTGCGGCCTCGCCAGGGACTTGG + Intergenic
1102962340 12:117100714-117100736 CGGTGCCCACAGAGGGGACTCGG + Intergenic
1103333166 12:120168884-120168906 CTGTGGCCATGCAAGGCACTGGG - Intronic
1103916585 12:124378884-124378906 CTGTGGGGACACAAGGCACGGGG + Intronic
1104492555 12:129207612-129207634 CTCTGGCCACACTGGAGACTCGG - Intronic
1104631212 12:130404131-130404153 CTGTGGGAACCCAAGGGAATCGG + Intronic
1108483926 13:50905928-50905950 TTGTGGCCACACTGTGGACTGGG + Intergenic
1110072882 13:71200001-71200023 CAGTGGCTTCACAAGGGAATAGG + Intergenic
1110819979 13:79902908-79902930 TTGTGCCCCCACAAGAGACTTGG - Intergenic
1112041464 13:95552561-95552583 CTGAGGCCCCTCAAGGGACAGGG + Intronic
1112213532 13:97405715-97405737 CAGTGGGCCCACAAGTGACTTGG - Intergenic
1112628608 13:101135696-101135718 CTGTGGCAACACAAGGAAGCAGG + Intronic
1113110222 13:106814658-106814680 CTGTGACCACAGAAGGATCTAGG + Intergenic
1113596682 13:111538783-111538805 CTGTGGCCACCCACCGGCCTGGG + Intergenic
1113847933 13:113403124-113403146 CTGTGGCCTCACCAGGCCCTCGG - Intergenic
1113961380 13:114128168-114128190 GTGTGGCCACACATGGGCCTTGG - Intronic
1114303238 14:21396823-21396845 CTGTGGCCTCCCAAAGGGCTGGG + Intronic
1116356472 14:43937144-43937166 CTGTGTCCAGCCTAGGGACTTGG - Intergenic
1116858562 14:49975114-49975136 CTTTGGCCCCTCAAGGCACTGGG + Intergenic
1116866111 14:50032917-50032939 CCTTGGCCACACAAAGTACTGGG + Intergenic
1117467285 14:56006091-56006113 CTGTGGCCTCGCAAGGTGCTGGG - Intergenic
1117988403 14:61410791-61410813 ATGTGACCACCCAAGGGACCTGG - Intronic
1118993773 14:70819349-70819371 CTGTGGCCTCCCAAAGTACTGGG + Intergenic
1120721452 14:87893528-87893550 CTGTGGGCATACAATGGGCTAGG - Intronic
1124092870 15:26623007-26623029 CTGTGCCCACAAAAGTGTCTGGG - Intronic
1124323959 15:28740322-28740344 CTGTGGCCTCCCAAGGTGCTGGG + Intergenic
1125437998 15:39668657-39668679 CTGTGACCAGACAAGTGACACGG - Intronic
1125780023 15:42256966-42256988 CTGTGGCCTCCCAAGGTGCTGGG + Intronic
1125789021 15:42348886-42348908 CTGGGGCCTCACATGGGTCTGGG - Intronic
1125874648 15:43133579-43133601 CTCTGGCCGCGCAAGTGACTGGG - Exonic
1127955173 15:63847077-63847099 CTGTGTGCAGCCAAGGGACTTGG + Intergenic
1129760754 15:78128125-78128147 CTGTGGCCACACAAGGGACTGGG + Intronic
1130106726 15:80934356-80934378 CAGTGGCCACATGAGGGACAGGG + Intronic
1130846043 15:87747085-87747107 CAGGGGACCCACAAGGGACTAGG - Intergenic
1131394830 15:92077912-92077934 CTGTGGCCACACAACTGCGTAGG - Intronic
1132607022 16:797825-797847 CTGTGGCCCCGCAGGGGACACGG + Exonic
1132955222 16:2588413-2588435 CTGTGGCCACTCCAAGTACTTGG + Intronic
1134880718 16:17743506-17743528 CTGTGGCTTCACAATTGACTTGG + Intergenic
1135256519 16:20945738-20945760 CTTTGGCCTCCCAAGGTACTGGG + Intronic
1135563559 16:23494657-23494679 CTGTGGCTACTCATGGGACTGGG - Intronic
1137266307 16:46871699-46871721 CTGTGTGCAGACTAGGGACTTGG - Intergenic
1138271891 16:55701631-55701653 CTGTGGTCAGACATGGGGCTAGG - Intronic
1139650361 16:68359225-68359247 CTCTGCTCACACAAGCGACTGGG - Exonic
1141634727 16:85308077-85308099 CTGTGGGCAAAGGAGGGACTTGG + Intergenic
1142250551 16:88989898-88989920 CTCTGGCCACACAGAAGACTCGG + Intergenic
1143210876 17:5186394-5186416 CTGTGTCCAGCCTAGGGACTTGG - Intronic
1143444952 17:7002535-7002557 CTTTGGCCACCCAAAGCACTGGG - Intronic
1143709050 17:8721152-8721174 TTGTGGGCACCCAAGGGCCTTGG - Intergenic
1143978632 17:10848610-10848632 CAGTGACCACAGAAGGAACTTGG + Intergenic
1145988467 17:29063374-29063396 CCTTGGCCACACAAAGCACTGGG - Intergenic
1146595868 17:34168149-34168171 CAGTGGCCTCACAAGGCACCTGG - Intronic
1147136773 17:38438592-38438614 TTGGAGCCACACAAGGGTCTCGG + Intronic
1148007313 17:44443922-44443944 CTTTGGCCCCACAAGGTGCTGGG + Intronic
1148018981 17:44541371-44541393 CTGAGGCCACACCATGGAGTGGG - Intergenic
1148070470 17:44905816-44905838 CTGTGCCCAGAGATGGGACTGGG - Intronic
1149902342 17:60492019-60492041 CTGTGTGCAGACTAGGGACTTGG + Intronic
1150723997 17:67636762-67636784 CTGTAAACACACCAGGGACTGGG + Intronic
1151697186 17:75723687-75723709 CAGTGGCCACCCCAGGGTCTGGG - Intronic
1152224847 17:79087962-79087984 CTGGGACCACACAAGAGACATGG - Intronic
1152738882 17:82010599-82010621 CTGTGCACACACACGGCACTTGG + Intronic
1153011970 18:547503-547525 CTGTGTGCACCCTAGGGACTTGG - Intergenic
1153865119 18:9260541-9260563 CAGTGGCCACAGTAGAGACTAGG - Intronic
1154326854 18:13397515-13397537 CTGTGGCCTCCCAAAGCACTGGG + Intronic
1157119688 18:44897227-44897249 CTGTGGCCACATAACTCACTTGG + Intronic
1160161518 18:76475696-76475718 CTCTGGCCACACTGGGCACTGGG + Intronic
1160463444 18:79056578-79056600 CTGTGGCCACCCAAAGTGCTGGG + Intergenic
1160628963 18:80232214-80232236 TGGTGTCCACACCAGGGACTGGG + Intronic
1160936172 19:1596263-1596285 CTGTGGCCTCCCAAAGTACTGGG + Intergenic
1162684792 19:12373287-12373309 CTGTGGCCTCCCAAAGTACTGGG - Intergenic
1163492274 19:17623783-17623805 CTGTGGGCACATTAGGGAGTGGG - Intronic
1164529152 19:29034630-29034652 CTGTGGCTACACCAGGGGGTGGG + Intergenic
1165170473 19:33888442-33888464 CTGTGCCCACACACGGGTCTAGG - Intergenic
1165377072 19:35450337-35450359 CTGGGCCCCCACAAGGGGCTGGG - Exonic
1165791255 19:38494051-38494073 CTGTGGCCTCCCAAAGGGCTAGG - Intronic
1166533249 19:43554886-43554908 CAGGGCCCACACAGGGGACTGGG + Intronic
1168295037 19:55374187-55374209 CTGTGACCACCCCAGGGCCTGGG - Intergenic
925712432 2:6754396-6754418 CTGGGGCCACATCTGGGACTGGG + Intergenic
926834351 2:17001107-17001129 CTTTGGCCTCACAAAGCACTGGG - Intergenic
926870202 2:17407821-17407843 CTGTGTGCACCCTAGGGACTTGG + Intergenic
927438242 2:23088824-23088846 CTGTGTCCAGTCTAGGGACTTGG - Intergenic
928139117 2:28712582-28712604 CTGTGCCCACCCAACAGACTGGG - Intergenic
928339212 2:30427045-30427067 CTGTGGCCTCCCAATGTACTGGG + Intergenic
929011800 2:37452199-37452221 CCTTGGCCTCACAAGTGACTGGG + Intergenic
929365464 2:41150393-41150415 CTGTGGCCTCCCAAAGTACTAGG + Intergenic
930866166 2:56123948-56123970 CTGTGTCCTCACAAGGCACAGGG + Intergenic
933815910 2:86068767-86068789 CTGTGGCTTCACAAGGGTCCCGG - Intronic
934518794 2:95006372-95006394 CAGTTGCCACACATGGGTCTCGG - Intergenic
935393471 2:102580142-102580164 CTTTGGGAACAAAAGGGACTAGG - Intergenic
935517563 2:104060776-104060798 TTGTTACCACACAAGGTACTTGG - Intergenic
935566519 2:104614331-104614353 CTGTGGCCACTCAAGTGGCTGGG + Intergenic
935815271 2:106841643-106841665 CTATGGCAACACAAGAGCCTGGG + Intronic
935948931 2:108311696-108311718 CTGTGTGCACCCTAGGGACTTGG + Intergenic
936772730 2:115934495-115934517 CTAATGCCACACAAGGGACATGG - Intergenic
937091852 2:119211873-119211895 CTGTGACCCCACAGGGGAATGGG + Intergenic
939740684 2:145902176-145902198 CTGTGTGCAGCCAAGGGACTTGG + Intergenic
939760349 2:146168693-146168715 CTTTGGCCTCCCAAAGGACTGGG + Intergenic
941606642 2:167605493-167605515 CTGAGGAGACACAAGGCACTCGG - Intergenic
943184026 2:184582160-184582182 ATGTTGCCACATAATGGACTTGG - Intergenic
943692774 2:190885438-190885460 CTGTGGCCACCCAAAGTGCTGGG + Intronic
943790621 2:191928312-191928334 CTGTGGCTACAGAAGGAAGTTGG - Intergenic
947820291 2:233064295-233064317 CTGTGGCCAGACCAGGCACTGGG - Intronic
948852435 2:240715018-240715040 CTGTGGCCTCCAAAGGGTCTGGG - Exonic
1169858022 20:10124389-10124411 CTGTGTCCAGCCTAGGGACTTGG - Intergenic
1170313542 20:15017854-15017876 CTGTGTGCACCCTAGGGACTTGG - Intronic
1170689037 20:18595518-18595540 CTGTGGCCTCCCAAAGTACTGGG + Intronic
1172181823 20:33008273-33008295 CTAGGGCCACACAGTGGACTGGG - Intronic
1172380179 20:34483072-34483094 CTGTGTGCACTCTAGGGACTTGG - Intronic
1173208118 20:41010740-41010762 CTGTAGCCTCAAAAGGGATTTGG - Intergenic
1173834382 20:46115698-46115720 CTGTGGCAACACAGGGGAGGAGG + Intergenic
1173844381 20:46178725-46178747 CTGGGTCCTCAGAAGGGACTGGG + Intronic
1173866667 20:46316920-46316942 CTGAGGCCACAGATGGGACAAGG + Intergenic
1174372079 20:50097555-50097577 CTGGGGCCAGACAAGGGAGGGGG + Intronic
1174394387 20:50237657-50237679 CTTTGGCCACACCGGGGACAGGG - Intergenic
1175195404 20:57239869-57239891 CTGTGTGCACCCTAGGGACTTGG - Intronic
1175351363 20:58322046-58322068 CTGTGGCTTCACAAAGGGCTGGG + Intronic
1175474418 20:59260783-59260805 CTGTGGCCACAGACAGAACTGGG - Intergenic
1175821851 20:61914237-61914259 CTGTGGCCACACAGGTAGCTGGG + Intronic
1177471324 21:21563999-21564021 CTGTGTGCACACTAGGGACTTGG + Intergenic
1177473935 21:21594205-21594227 CTGTGTCCAGTCTAGGGACTTGG - Intergenic
1179060930 21:37978630-37978652 CTGTGGCCTCACAAAGTGCTGGG + Intronic
1180958853 22:19753673-19753695 CTGGGGCCACAGAAGGGAAGGGG + Intergenic
1181585748 22:23852657-23852679 CCGTGGCCTCCCAAGGTACTTGG + Intergenic
1182393684 22:30020152-30020174 CTCTGGTCTCAAAAGGGACTTGG - Exonic
1184241592 22:43213982-43214004 CTCTGGCCACACCAGGCACCTGG + Intronic
1184262445 22:43326771-43326793 CTGAAGCCACATAACGGACTGGG - Intronic
1184311903 22:43651231-43651253 CTGTGTGCAGACTAGGGACTTGG + Intronic
950226125 3:11235856-11235878 CTGTGTCCAGCCAAAGGACTGGG - Intronic
950626677 3:14252632-14252654 CTGGGGCCACACATGGCAATCGG - Intergenic
950635599 3:14312187-14312209 GTGGGGGCACACAAGGGAGTAGG + Intergenic
950702178 3:14758190-14758212 CTCTGGGCACACAAGAGCCTGGG + Intronic
952136422 3:30427471-30427493 CTGTGGCCTCCCAAAGCACTGGG - Intergenic
953216460 3:40923251-40923273 CTGTGTCAACACAACTGACTAGG - Intergenic
953497592 3:43401903-43401925 CTGTAGTCACTCAAGGGAGTGGG + Intronic
954108416 3:48421246-48421268 CTGGGGCCTCACTAGGGTCTGGG + Exonic
954385826 3:50243279-50243301 CTGTGGCCAAAGAAGGGGCCTGG - Intronic
954591539 3:51787763-51787785 CTGTGTGCACCCTAGGGACTTGG + Intergenic
956474928 3:69609870-69609892 CTGTGTGCAGCCAAGGGACTTGG + Intergenic
956474934 3:69609901-69609923 CTGTGTGCAGCCAAGGGACTTGG + Intergenic
958550614 3:95607423-95607445 CTGTGTGCACCCCAGGGACTTGG - Intergenic
958993430 3:100873868-100873890 CTGTGGCCAAACAGGGGCTTGGG + Intronic
959319070 3:104848131-104848153 CTGTGTCCAGCCTAGGGACTTGG + Intergenic
960718535 3:120602684-120602706 CTGGGGCCAGACAAGGGCTTAGG - Intergenic
961518452 3:127453113-127453135 CTGTGGCCAAACAAGGCTCTTGG - Intergenic
961564492 3:127754006-127754028 CTGTGGCTACAGAATGGGCTAGG - Intronic
962321125 3:134391430-134391452 CTGTGGCCACTCAAAGTGCTGGG - Intergenic
962474021 3:135740123-135740145 CTGTGGTCCCAGAAGGCACTGGG - Intergenic
963067002 3:141271928-141271950 CTGTCGCCACAGAAGGAAGTGGG + Intronic
963071067 3:141305733-141305755 CTGTGTCCACACATGGGGGTGGG - Intergenic
963894567 3:150671878-150671900 CTGTGGCCTCTCAAAGGGCTGGG + Intronic
965069800 3:163905188-163905210 CTTTGGCCACCCAAAGTACTGGG + Intergenic
966164607 3:177003662-177003684 CTGTGGCCTCCCAAGGTGCTGGG - Intergenic
966890332 3:184402923-184402945 CTGTGGCCTCCCAAGGTGCTGGG + Intronic
968158057 3:196399689-196399711 CTGTGGCCTCCCAAAGGACTGGG + Intronic
968327717 3:197834891-197834913 CTGTGGCCACCCAAAGTGCTGGG - Intronic
968426375 4:526275-526297 CTGGGGCCACACGGGGGCCTGGG - Intronic
968597690 4:1493717-1493739 CTGTGGCCACAGCAAGCACTGGG + Intergenic
969046067 4:4337704-4337726 CTGTGGCCAGCCAAGGGTTTTGG + Intergenic
969675754 4:8613510-8613532 CTGTGGCTACACTGGGGTCTGGG + Intronic
971478821 4:27096293-27096315 CTGTGGCCACAAAAAGGCCAGGG - Intergenic
971815022 4:31476512-31476534 CTGTGTGCAGCCAAGGGACTTGG - Intergenic
973215511 4:47664990-47665012 CTGAGGCAAAATAAGGGACTGGG + Intronic
976003585 4:80401386-80401408 CTGTGTGCACACTAGGGACTTGG + Intronic
978939043 4:114415382-114415404 CTGTGGGCACTCTAGGGACTTGG + Intergenic
979390144 4:120118148-120118170 CTGTGTGCAGACTAGGGACTTGG - Intergenic
981155391 4:141428837-141428859 CCTTGGCCTCCCAAGGGACTGGG + Intergenic
982019626 4:151190494-151190516 CTGTGTGCACTCTAGGGACTTGG + Intronic
983862672 4:172727180-172727202 CTATGGGCACACAAGGAGCTTGG - Intronic
984232124 4:177112209-177112231 CTGTGTGCAGCCAAGGGACTTGG - Intergenic
984282899 4:177693639-177693661 CTTTGGCCACTCAAAGTACTGGG - Intergenic
984327137 4:178269025-178269047 CTGTGTGCAGCCAAGGGACTTGG - Intergenic
985394280 4:189525524-189525546 CTGTGTGCACCCTAGGGACTTGG + Intergenic
986128574 5:4906157-4906179 CTTTGGCCACAAGGGGGACTGGG - Intergenic
988103136 5:26708175-26708197 CTGTGTGCAGCCAAGGGACTTGG + Intergenic
988426877 5:31074475-31074497 CTGTGTGCAGCCAAGGGACTTGG - Intergenic
988649393 5:33131696-33131718 CTGTGTGCAGACTAGGGACTTGG + Intergenic
989287079 5:39713635-39713657 TTGTGGCCTCACAAGAGAGTTGG + Intergenic
990182688 5:53180036-53180058 ATGTGGCCAAACATGGAACTTGG + Intergenic
990358896 5:54997984-54998006 CTATGGCCAGAGAAGGGATTTGG + Intronic
991119455 5:62994341-62994363 CTGTGGGCAGTCTAGGGACTTGG - Intergenic
993711590 5:91230545-91230567 CTGTGTACAGACTAGGGACTTGG - Intergenic
995621376 5:114029817-114029839 CTCTGGCCAGCCAAGGGACAGGG + Intergenic
997092940 5:130878392-130878414 CTGTGTGCAACCAAGGGACTTGG + Intergenic
997492050 5:134285507-134285529 CTGTGTGCAGCCAAGGGACTTGG - Intergenic
997781195 5:136660327-136660349 CTCTGGCAATACAAGGGTCTGGG - Intergenic
999245570 5:150152720-150152742 CTCTGCCCACAGAAGGGACCTGG - Intronic
999297160 5:150466888-150466910 CTGTGGCTACAAAAGGGCTTTGG + Intergenic
999321818 5:150619863-150619885 CTGGGGTCACACAGGGGGCTGGG + Intronic
1000248016 5:159465913-159465935 CTGTGGCCATTCAAAGGGCTAGG + Intergenic
1001102840 5:168828378-168828400 CTGTGGCCTCACAATGTACTGGG - Intronic
1002388684 5:178891912-178891934 CTGTGGGAGAACAAGGGACTAGG - Intergenic
1003526078 6:6898747-6898769 CTTTGGCCACCCAAAGTACTGGG + Intergenic
1004550969 6:16646757-16646779 CTGTGGGAACACAAAGGAGTGGG - Intronic
1007566348 6:42853844-42853866 TTGTGGGCACACAGGGGACTGGG - Intronic
1008535484 6:52503708-52503730 CAGTGGCCACAGAAGGGAGGGGG + Intronic
1009480964 6:64157579-64157601 CTGTGGGCATCCTAGGGACTTGG + Intronic
1011264106 6:85497531-85497553 CTGTGTCCAGCCTAGGGACTTGG - Intergenic
1011950635 6:92959623-92959645 CTGTGTGCACCCTAGGGACTTGG - Intergenic
1012261700 6:97094890-97094912 CTCTGGCCACACAAGGAAATTGG + Intronic
1012719016 6:102717468-102717490 CTTTGGACACAAAAGGGCCTTGG + Intergenic
1012830780 6:104201435-104201457 CTGTGTGCAGCCAAGGGACTTGG + Intergenic
1012975157 6:105772792-105772814 ATGTGGGTATACAAGGGACTGGG + Intergenic
1013927894 6:115494667-115494689 CTGTGTGCAGACTAGGGACTTGG - Intergenic
1016415945 6:143833996-143834018 CTTTGGCCTCACAAAGCACTGGG - Intronic
1017122927 6:151041030-151041052 GTGTGGCCACAGGAGGAACTCGG - Intronic
1017366233 6:153643398-153643420 CTGTGGCCTCTCAAAGGGCTGGG + Intergenic
1018924045 6:168194389-168194411 CTGCGGCCACACAGCAGACTTGG - Intergenic
1019556267 7:1633143-1633165 CAGTGGCCACGTGAGGGACTGGG - Intergenic
1019803436 7:3105254-3105276 CTGGGGCCAGAGAAGGGGCTTGG - Intergenic
1020209968 7:6151691-6151713 CTGTGGCCTCCCAAAGGGCTGGG + Intronic
1021349433 7:19572415-19572437 GTGTGTCTACACAAGGTACTGGG - Intergenic
1022411355 7:30141004-30141026 CTGTGGTCACACAGGGAACAAGG - Intronic
1022415981 7:30177375-30177397 CTGTCTCCACTCAAAGGACTTGG - Intergenic
1023837550 7:44077230-44077252 ATGTGGCCACAAAAGGTGCTCGG - Intronic
1024215574 7:47245653-47245675 GTGTGGCCACACCAGGGCCATGG - Intergenic
1024558661 7:50625465-50625487 CTGTTGACACACAAGTAACTTGG - Intronic
1027403597 7:77834869-77834891 ATGTGGCCACACAGGTCACTTGG - Intronic
1027624730 7:80531922-80531944 CTGTGGGCAGCCTAGGGACTTGG + Intronic
1028971766 7:96867255-96867277 CTGTTGCCCCTCAAGTGACTAGG + Intergenic
1029804427 7:102981692-102981714 CTGTGTCCACACATGGCAGTAGG + Intronic
1030079978 7:105769038-105769060 CTGAGGCCACACAAGTGATAGGG - Intronic
1031995829 7:128230219-128230241 CTGTGGAAACAAAGGGGACTTGG - Intergenic
1032410538 7:131690832-131690854 CTATGGCCACACCAGGGTCAAGG - Intergenic
1034531416 7:151698258-151698280 CTGAGGCCTCACAAGGGACCTGG - Intronic
1034733111 7:153405092-153405114 CTGTGGTCACAAAAGGGGTTTGG - Intergenic
1035645013 8:1211981-1212003 CTGTGGAAACACAAGGCTCTTGG + Intergenic
1036191438 8:6674306-6674328 ATGGGGCCACACAAGGGAGATGG - Intergenic
1037475164 8:19249981-19250003 CGGTGGCCTCCCAAAGGACTGGG - Intergenic
1038060194 8:23904048-23904070 CTGAGGCAACACAAGGGCCTGGG - Intergenic
1038163015 8:25058474-25058496 CTGTGGCCTCCCAAAGGGCTGGG - Intergenic
1038216911 8:25570148-25570170 CTTTGGTCACACAGGGGACAAGG - Intergenic
1039614121 8:38941304-38941326 CTGTGGCCTCCCAAAGTACTGGG + Intronic
1039850185 8:41358226-41358248 CTGGGGGCTCTCAAGGGACTCGG - Intergenic
1040388162 8:46927938-46927960 CTGTAGCCACATGAGGGAGTGGG - Intergenic
1041901607 8:62988617-62988639 CTGTGTACATCCAAGGGACTTGG - Intronic
1044205760 8:89490625-89490647 CTGTGTTCAGCCAAGGGACTTGG + Intergenic
1044282642 8:90374798-90374820 CTGTGTGCAGACTAGGGACTTGG - Intergenic
1044796097 8:95899323-95899345 CTGTGGCCTCCCAAGGTGCTGGG - Intergenic
1045385868 8:101670468-101670490 CTGTGCCTAGACCAGGGACTGGG + Intergenic
1049731066 8:144178818-144178840 CTGGGGACACACCAAGGACTGGG - Intronic
1050486763 9:6142628-6142650 CTGTGGCCACAGCTAGGACTTGG + Intergenic
1051573133 9:18583223-18583245 CTGTGTGCACCCTAGGGACTTGG + Intronic
1051616447 9:19011504-19011526 CTCTGGGCACACAAGAAACTTGG - Intronic
1051619488 9:19036492-19036514 CTGTGTCCAGCCTAGGGACTTGG + Intronic
1052860558 9:33435419-33435441 CTTTGGCCATACACGGGGCTGGG + Intergenic
1053684311 9:40507166-40507188 ATGTGGCCACAGGAGGAACTCGG - Intergenic
1053934278 9:43135452-43135474 ATGTGGCCACAGGAGGAACTCGG - Intergenic
1054279414 9:63117787-63117809 ATGTGGCCACAGGAGGAACTCGG + Intergenic
1054297405 9:63342630-63342652 ATGTGGCCACAGGAGGAACTCGG - Intergenic
1054395423 9:64647138-64647160 ATGTGGCCACAGGAGGAACTCGG - Intergenic
1054430070 9:65152338-65152360 ATGTGGCCACAGGAGGAACTCGG - Intergenic
1054500314 9:65869194-65869216 ATGTGGCCACAGGAGGAACTCGG + Intergenic
1054918309 9:70516434-70516456 CTTTGGCCTCTCAAGGTACTGGG + Intergenic
1055282920 9:74695569-74695591 CTGTGGGCACACAACTAACTAGG - Intergenic
1056043490 9:82691887-82691909 CTTCGGCCACACAAAGCACTGGG + Intergenic
1056065188 9:82926141-82926163 CTGTGGCCTCCCAAGGTCCTGGG - Intergenic
1056473810 9:86932909-86932931 CTTTGGCCTCCCAAAGGACTGGG - Intergenic
1056674001 9:88657618-88657640 CTGCGGACAGACATGGGACTAGG - Intergenic
1057426559 9:94955192-94955214 AACTGGCCACACAAGTGACTCGG + Exonic
1057732467 9:97622183-97622205 CTGTGGGCAGTCTAGGGACTTGG + Intronic
1060782346 9:126422100-126422122 CTGTGGCGACACAAAGGAAAGGG - Intronic
1061033541 9:128101024-128101046 ATGGGGCCCCACAAGGGACAAGG + Intronic
1061224738 9:129274523-129274545 GTGTAGACACGCAAGGGACTCGG + Intergenic
1061644400 9:131988726-131988748 CTTTGGCCTCCCAAGGAACTGGG + Intronic
1062249825 9:135588499-135588521 AGCTGGCCATACAAGGGACTGGG + Intergenic
1062342814 9:136101253-136101275 CTGTGTCCATACCAGGCACTGGG + Intergenic
1185472202 X:390712-390734 CTGTGGCCACACAGGAGACCCGG - Intergenic
1187198093 X:17107769-17107791 CTGTGGCAAGACTAGAGACTAGG + Intronic
1187213792 X:17254919-17254941 CTCTGGGAACAGAAGGGACTAGG + Intergenic
1187452123 X:19407688-19407710 TTGTGGCCACACAAGGGAAATGG + Intronic
1187452250 X:19408845-19408867 TTGTGGCCACACGAGGGAAATGG - Intronic
1188785122 X:34336303-34336325 CTGTGTGCAGCCAAGGGACTTGG - Intergenic
1193221251 X:78929234-78929256 CTGTGTGCAGACTAGGGACTTGG - Intergenic
1194504582 X:94716396-94716418 CTGTGGCCTCCCAAAGTACTAGG + Intergenic
1197392353 X:125883384-125883406 CTGAGGCTGCACAAGGGAGTGGG - Intergenic
1198486468 X:137092417-137092439 CAGTGGCCACACAATGGAAAAGG - Intergenic
1198777215 X:140192720-140192742 CTTAGGCAACAGAAGGGACTGGG - Intergenic
1198839761 X:140843823-140843845 CTGTGGCCACAAATGAGTCTTGG - Intergenic
1199719378 X:150531422-150531444 CTGTGTGCACACCAGGCACTGGG + Intergenic