ID: 1129761388

View in Genome Browser
Species Human (GRCh38)
Location 15:78131127-78131149
Sequence GCGGGGCCTGTGTTGGGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1138
Summary {0: 1, 1: 1, 2: 10, 3: 94, 4: 1032}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129761376_1129761388 4 Left 1129761376 15:78131100-78131122 CCGAGAAAAGGGAGGGGCGGCGG 0: 1
1: 0
2: 3
3: 18
4: 172
Right 1129761388 15:78131127-78131149 GCGGGGCCTGTGTTGGGGGCCGG 0: 1
1: 1
2: 10
3: 94
4: 1032
1129761368_1129761388 17 Left 1129761368 15:78131087-78131109 CCTCGGCCAGCGACCGAGAAAAG 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1129761388 15:78131127-78131149 GCGGGGCCTGTGTTGGGGGCCGG 0: 1
1: 1
2: 10
3: 94
4: 1032
1129761372_1129761388 11 Left 1129761372 15:78131093-78131115 CCAGCGACCGAGAAAAGGGAGGG 0: 1
1: 0
2: 1
3: 10
4: 109
Right 1129761388 15:78131127-78131149 GCGGGGCCTGTGTTGGGGGCCGG 0: 1
1: 1
2: 10
3: 94
4: 1032

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129761388 Original CRISPR GCGGGGCCTGTGTTGGGGGC CGG Intronic