ID: 1129764302

View in Genome Browser
Species Human (GRCh38)
Location 15:78151675-78151697
Sequence GACCTGAAGTCCAAAGTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 527
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 478}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129764302 Original CRISPR GACCTGAAGTCCAAAGTTCA GGG Intronic
901156849 1:7145951-7145973 GACAAGAAGGCCAAAGCTCAGGG - Intronic
901903577 1:12389087-12389109 AACTTGGAGTCCAATGTTCAAGG + Intronic
901920460 1:12532617-12532639 AACTTGTAGTCCAATGTTCAAGG + Intergenic
903257177 1:22110606-22110628 GTTCTGGAGTCAAAAGTTCAAGG - Intergenic
903759358 1:25687056-25687078 GACCTGAACTCCCAGGCTCAAGG - Intronic
904216712 1:28926124-28926146 CACCTGAAGTCAGAAGTTCGAGG + Intronic
904336170 1:29799835-29799857 AACTTGGAGTCCAATGTTCAAGG - Intergenic
904694921 1:32324146-32324168 CACCTGTAGTCCAAAGTACTTGG + Intronic
905209369 1:36362935-36362957 CACCTGAAGTCAGGAGTTCAAGG + Intronic
906050821 1:42870064-42870086 AACTTGGAGTCCAATGTTCAAGG - Intergenic
906879996 1:49579087-49579109 AACCTGGAGTCCAATGTTCAAGG - Intronic
907377925 1:54059368-54059390 CACCTGAGGTCAAGAGTTCAAGG - Intronic
907542652 1:55230139-55230161 CACCTGAGGTCAAGAGTTCAAGG - Intergenic
907596872 1:55728068-55728090 AACTTGGAGTCCAATGTTCAAGG - Intergenic
907655406 1:56337118-56337140 GAGATGAAGTCCAAACTCCATGG - Intergenic
907976535 1:59436318-59436340 GGACTGAAGTTCAAATTTCAGGG - Intronic
908100468 1:60785938-60785960 CACCTGAAGTCAGGAGTTCAAGG + Intergenic
908253603 1:62284535-62284557 CACCTGAAGTCAGGAGTTCAAGG - Intronic
908282978 1:62562431-62562453 CACCTGAGGTCAAGAGTTCAAGG - Intronic
908402129 1:63781326-63781348 GATCAGAAGTCCAAACTCCAAGG - Intronic
908911696 1:69078955-69078977 GGCTTAAAGTCCAAAGATCAAGG - Intergenic
908978932 1:69930591-69930613 GAGTTGATGTCAAAAGTTCAGGG - Intronic
909661724 1:78091028-78091050 GACCTAAAGTACAAAGTTTTGGG - Intronic
909681776 1:78299831-78299853 TACCTGTATTTCAAAGTTCAGGG + Intergenic
910141239 1:84029553-84029575 AACTTGGAGTCCAATGTTCAAGG - Intergenic
910369269 1:86498730-86498752 GACCTGAAGGCGGAAATTCACGG + Exonic
910725101 1:90329352-90329374 AACTTGGAGTCCAATGTTCAAGG - Intergenic
910798470 1:91121595-91121617 CACCTGAAGGCCAAAGCCCATGG + Intergenic
911109447 1:94166947-94166969 AACCTGGAGTCCAATTTTCAAGG + Intronic
911571673 1:99524982-99525004 TACCTGGAGTCTATAGTTCAGGG - Intergenic
914732080 1:150380564-150380586 CACCTGAGGTCAGAAGTTCAAGG - Intronic
915132085 1:153702500-153702522 CACCTGAGGTCAGAAGTTCAAGG - Intergenic
915923276 1:159994960-159994982 AACTTGGAGTCCAATGTTCAAGG + Intergenic
917346709 1:174035739-174035761 GTCCTGAAGGCCAAAGTACATGG + Intergenic
917461237 1:175232066-175232088 AACCTGGAGTCCAATGTTCGAGG + Intergenic
921187141 1:212679859-212679881 CACCTGAGGTCAGAAGTTCAAGG + Intergenic
921255779 1:213338087-213338109 GAGCTGAATTCCTAAGTTCTTGG + Intergenic
922268281 1:224008903-224008925 AACCTGCAGTCCTAAGTTCCAGG + Intergenic
922549047 1:226480617-226480639 GTCCTGGAGTCCAAAGGCCAGGG - Intergenic
923029798 1:230239482-230239504 AACTTGGAGTCCAATGTTCAAGG + Intronic
923132487 1:231089167-231089189 CACCTGAGGTCAGAAGTTCAAGG + Intergenic
923185552 1:231569567-231569589 AACTTGGAGTCCAATGTTCAAGG + Intronic
924412983 1:243825911-243825933 CACCTGAAGTCAAGAGTTCGAGG + Intronic
924489035 1:244516738-244516760 CACCTGAAGTCAAGAGTTCGAGG - Intronic
924634091 1:245768385-245768407 GATCTGAAGTCAAAAGGACATGG + Intronic
924954607 1:248914533-248914555 AGCCTGAACTCCAAAGTCCATGG + Intronic
1063868788 10:10396147-10396169 GGCCAGAAGTCCAAACTGCAGGG - Intergenic
1064514769 10:16134959-16134981 CACCTGAGGTCAAGAGTTCAAGG + Intergenic
1064734965 10:18372623-18372645 GACCTGAGGTCAGAAGTTCAAGG - Intronic
1064951589 10:20857045-20857067 CACCTGAGGTCAGAAGTTCAAGG - Intronic
1064981435 10:21171115-21171137 CACCTGAGGTCCAGAGTTCGAGG + Intronic
1066671926 10:37849462-37849484 CACCTGAAGTCAGGAGTTCAAGG + Intronic
1066673593 10:37864691-37864713 CACCTGAAGTCAGGAGTTCAAGG - Intergenic
1067381804 10:45780970-45780992 CACCTGAGGTCAAGAGTTCAAGG - Intronic
1067889503 10:50121610-50121632 CACCTGAGGTCAAGAGTTCAAGG - Intronic
1069914423 10:71778559-71778581 GACTTGAAACCCAGAGTTCATGG - Intronic
1070661665 10:78310928-78310950 GACCCCAAGTGCAAAGTCCAAGG + Intergenic
1071109525 10:82138777-82138799 GACTTGGAGTCTAATGTTCAAGG + Intronic
1071374507 10:84988796-84988818 TGCCTGAAGTCCGGAGTTCAAGG - Intergenic
1073145860 10:101281395-101281417 CACCTGAACTCAAGAGTTCAAGG - Intergenic
1073266026 10:102228954-102228976 GGCATGAACACCAAAGTTCATGG - Exonic
1073551082 10:104402175-104402197 GACACCAAGTCCAAAGCTCAGGG - Intronic
1073795303 10:106980953-106980975 AACCTTCAGTTCAAAGTTCAAGG - Intronic
1074202737 10:111253610-111253632 GACGTGGAGTCCATTGTTCAAGG - Intergenic
1074608972 10:115003137-115003159 CACCTGAAGTCAGGAGTTCAAGG - Intergenic
1074878052 10:117629898-117629920 AACCTGGAGTCCGATGTTCAAGG + Intergenic
1074974775 10:118571192-118571214 GTTCTGAATTCCAACGTTCAGGG - Intergenic
1075038087 10:119086117-119086139 TACCTGAGGTCAGAAGTTCAAGG - Intergenic
1075188812 10:120287269-120287291 ATCCTCATGTCCAAAGTTCAGGG + Intergenic
1075353209 10:121744940-121744962 GCCATGAAGTCCAACGTTCCAGG - Intronic
1075913939 10:126149699-126149721 AACTTGAAGTCCGATGTTCAAGG - Intronic
1076150208 10:128155707-128155729 TAACTGAAGTCCATAGTTTACGG + Intergenic
1076434348 10:130429931-130429953 GACCTGAAGCCCACAGCCCACGG + Intergenic
1077345293 11:2045950-2045972 AACTTGGAGTCCAATGTTCAAGG + Intergenic
1077678012 11:4214582-4214604 CACCTCAAGACCAGAGTTCAGGG - Intergenic
1077839086 11:5954211-5954233 GACTTGAAGACCAAAATGCAAGG - Intergenic
1078460061 11:11507924-11507946 AACTTGGAGTCCAATGTTCAAGG - Intronic
1078510402 11:11980448-11980470 GACCTGGAGTCCAAACTGCATGG + Intronic
1079994031 11:27276290-27276312 GGCTGGAAGTCCAAAGATCAAGG - Intergenic
1080221510 11:29910771-29910793 AACTTGGAGTCCAATGTTCAAGG - Intergenic
1080251891 11:30242914-30242936 AACTTGGAGTCCAATGTTCAAGG - Intergenic
1081135538 11:39435977-39435999 CACCTGAGGTCAATAGTTCAAGG + Intergenic
1081433075 11:42997860-42997882 AACCTGGAGTCGAATGTTCAAGG + Intergenic
1084145987 11:67265750-67265772 GACCCCAAGTCTAGAGTTCAGGG + Intergenic
1085064810 11:73484858-73484880 AACCTGGAGTCCGATGTTCAAGG + Intronic
1086057170 11:82660539-82660561 AACCTGAAGTCCAATGTTTGAGG + Intergenic
1086141291 11:83503565-83503587 AACCTGGAGTCCGATGTTCAAGG + Intronic
1086278209 11:85157152-85157174 AACTTGGAGTCCAATGTTCAAGG - Intronic
1086473748 11:87147101-87147123 CACCTGAAGTCAGGAGTTCAAGG + Intronic
1087417621 11:97878166-97878188 GACTTAAAGTCCAAAGTTTGAGG + Intergenic
1088147746 11:106703135-106703157 GACTTGGAGTCCAATGTTCAAGG - Intronic
1088583791 11:111340906-111340928 CACCTGAGGTCAAGAGTTCAAGG + Intergenic
1089217344 11:116842551-116842573 CACCTGAACTCCAAAGGGCAGGG - Intergenic
1090774238 11:129949047-129949069 GATCTGAAGTCTAAAGATCTTGG - Intronic
1091731911 12:2887257-2887279 CACCTGAGGTCAAGAGTTCAAGG + Intronic
1091774823 12:3177649-3177671 CACCTGAGGTCAGAAGTTCAAGG - Intronic
1092895893 12:13010047-13010069 CACCTGAGGTCAAGAGTTCAAGG - Intergenic
1093495489 12:19752145-19752167 CACTTGAAGTCAGAAGTTCAAGG - Intergenic
1094359643 12:29616451-29616473 CACCTGAGGTCAAGAGTTCAAGG + Intronic
1094450309 12:30576888-30576910 AACTTGGAGTCCAACGTTCAGGG - Intergenic
1095314058 12:40737482-40737504 AACCTGGAGTCCGATGTTCAAGG + Intronic
1095565982 12:43623509-43623531 GACATGAAGTCCAACTTACAAGG + Intergenic
1097204051 12:57304963-57304985 CACCTGAAGTCAGGAGTTCAAGG + Intronic
1097255761 12:57672874-57672896 AACCTGGAGTCCAACGTTCAAGG + Intergenic
1097448505 12:59706823-59706845 GACCTGAAGTTCAAATTCAATGG - Intronic
1097522220 12:60683499-60683521 GACCTGAAGTGTGAAGATCATGG - Intergenic
1099291564 12:80782535-80782557 AACTTGTAGTCCAATGTTCAAGG - Intergenic
1099689694 12:85937277-85937299 AACCTGCAGTCCAATGTTCAAGG - Intergenic
1099697767 12:86043417-86043439 AACTTGGAGTCCAATGTTCAAGG + Intronic
1099735976 12:86566404-86566426 AACTTGGAGTCCAATGTTCAAGG - Intronic
1099998155 12:89802286-89802308 GGCCTGAATTCCAAATTTCATGG + Intergenic
1100339348 12:93663460-93663482 GTCCTGAAATCCAAAGGCCAGGG - Intergenic
1100597248 12:96082262-96082284 CACCTGAGGTCAGAAGTTCAAGG + Intergenic
1101854788 12:108433206-108433228 AACTTGGAGTCCAATGTTCAAGG + Intergenic
1102032242 12:109747311-109747333 CACCTGAAGTCAGGAGTTCAAGG - Intronic
1102985673 12:117276499-117276521 CACCTGAGGTCAAGAGTTCAAGG - Intronic
1103148623 12:118617505-118617527 AACTTGGAGTCCAATGTTCAAGG - Intergenic
1103406104 12:120676643-120676665 CACCTGAAGTCGGGAGTTCAAGG - Intergenic
1103636036 12:122306147-122306169 AACTTGAAGTCCAATGTTCTAGG - Intronic
1105557530 13:21460405-21460427 GCCCTGAACTCCAAGGCTCAAGG + Intergenic
1105670223 13:22605399-22605421 AACCTGGAGTCCGACGTTCAAGG + Intergenic
1106064631 13:26333356-26333378 CACCTGAGGTCCGGAGTTCAAGG - Intronic
1106080001 13:26492381-26492403 AACCTGGAGTCCAATGTTCAAGG + Intergenic
1107308755 13:39053127-39053149 AACTTGCAGTCCAATGTTCAAGG - Intergenic
1107565097 13:41594197-41594219 GCCCAGGAGTTCAAAGTTCAAGG - Intronic
1107972053 13:45652982-45653004 AACCTGAAGTCTAATGTCCAAGG + Intergenic
1108568389 13:51724723-51724745 CACCTGAAGTCCATAGTTTAGGG + Intronic
1108914691 13:55592089-55592111 AACTTGGAGTCCAATGTTCAAGG + Intergenic
1109518968 13:63484377-63484399 AACCTGGAGTCCAATGTTCAAGG - Intergenic
1109951441 13:69505679-69505701 AACCTGGAGTCCAATATTCAAGG + Intergenic
1111023945 13:82493722-82493744 AACTTGAAGTCCGATGTTCAAGG + Intergenic
1112438285 13:99407282-99407304 ATACTGAAGTCCAAACTTCAGGG + Intergenic
1112706794 13:102079497-102079519 CACTTGAAGTTCAGAGTTCAAGG - Intronic
1112863530 13:103864875-103864897 AACCTGCAGTCCAGTGTTCAAGG - Intergenic
1114229013 14:20763657-20763679 CACCTGAGGTCAAGAGTTCAAGG + Intergenic
1115544931 14:34457194-34457216 CACCTGAGGTCAAGAGTTCAAGG - Intronic
1115604986 14:34992149-34992171 CACCTGAAGTCAGGAGTTCAAGG - Intronic
1116068414 14:40011778-40011800 AACCTGGAATCCAATGTTCAAGG - Intergenic
1117961398 14:61166110-61166132 AACTTGGAGTCCAATGTTCAAGG - Intergenic
1118282009 14:64438089-64438111 CACCTGAGGTCAAAAGTTCGAGG - Intronic
1119060179 14:71465843-71465865 AAGTTGGAGTCCAAAGTTCAAGG + Intronic
1119236541 14:73024915-73024937 GACCTGAAGTCAGTATTTCAGGG + Exonic
1120126929 14:80755198-80755220 AACTTGGAGTCCAATGTTCAAGG - Intronic
1121687066 14:95843681-95843703 GCCCTGGAGCCCAAATTTCAGGG + Intergenic
1123917428 15:25046890-25046912 AGCTTGAAGTCCAATGTTCAAGG - Intergenic
1124532355 15:30518723-30518745 GACCTGAGGTCAGGAGTTCAAGG + Intergenic
1124766298 15:32488922-32488944 GACCTGAGGTCAGGAGTTCAAGG - Intergenic
1125773877 15:42192996-42193018 CACCTGAGGTCGAGAGTTCAAGG - Intronic
1125812764 15:42555925-42555947 GATCTGAAATTCAAATTTCATGG - Intronic
1125958794 15:43811194-43811216 CACCTGAAGTCAGGAGTTCAAGG + Intronic
1127412365 15:58722119-58722141 CACCTGAGGTCAAGAGTTCAAGG + Intronic
1127478487 15:59356784-59356806 GTCCTGAACTCCTAAGCTCAAGG + Intronic
1128253358 15:66179349-66179371 CACCTGAAGTCAGGAGTTCAAGG - Intronic
1128426472 15:67546438-67546460 GACCTGAAGTCAGCAGTTGAGGG + Intronic
1129003442 15:72352880-72352902 CACCTGAAGTCAGAAGTTCAAGG - Intronic
1129264282 15:74385706-74385728 GAACTGAGGTCCCAAGTTGAGGG - Intergenic
1129764302 15:78151675-78151697 GACCTGAAGTCCAAAGTTCAGGG + Intronic
1129961837 15:79693498-79693520 AACTTGGAGTCCAATGTTCAAGG + Intergenic
1134307210 16:13043703-13043725 GACCTGAAGTGTAAAGTGCATGG - Intronic
1135168047 16:20157722-20157744 GAGCTGAAGTCCAGACATCATGG + Intergenic
1135502391 16:23007999-23008021 GACTTGAAATCCAGATTTCAGGG + Intergenic
1135936629 16:26785942-26785964 GACCCTAAGTCCAAAGCTGAGGG - Intergenic
1136027356 16:27477521-27477543 CACCTGAGGTCAAGAGTTCAAGG - Intronic
1136909087 16:34132090-34132112 GACGAGATGTCCAAAGGTCAAGG - Intergenic
1139010687 16:62629293-62629315 CACCTGAAGTCAGGAGTTCAAGG - Intergenic
1139050249 16:63116056-63116078 GACTTGAAGTATAAACTTCATGG - Intergenic
1139280612 16:65767194-65767216 GCCCTGAAGGACAAAGTTCATGG - Intergenic
1140395203 16:74620500-74620522 CACCTGAGGTCAGAAGTTCAAGG - Intergenic
1140585700 16:76289313-76289335 GACTTGAAGTCCAAACTGGATGG - Intronic
1141043834 16:80696911-80696933 CACCTGAAGTCAGGAGTTCAAGG + Intronic
1141155956 16:81597389-81597411 GGCGTGAAGTCCAAAGGTCTTGG + Intronic
1141191635 16:81829325-81829347 CACCTGAAGTCAGGAGTTCAAGG - Intronic
1141663413 16:85453652-85453674 GTCCTGAAGTCTAGAGCTCAGGG + Intergenic
1142716450 17:1749616-1749638 GACCTGAGGTCAGGAGTTCAAGG - Intronic
1143572918 17:7771932-7771954 CACCTGAGGTCAAGAGTTCAAGG - Intronic
1143883130 17:10045476-10045498 CACCTGAAGTCAGGAGTTCAAGG + Intronic
1144552430 17:16252997-16253019 GACCTGAAGTCAGGAGTTCAAGG + Intronic
1146600343 17:34209187-34209209 GTCCTGAAGTCCAAAGGCCAGGG + Intergenic
1148007489 17:44445722-44445744 CACCTGAAGTCAGAAGTTCGAGG - Intronic
1148378627 17:47174735-47174757 CACCTGAGGTCAAGAGTTCAAGG + Intronic
1150650859 17:67009198-67009220 GGCTTGAAGTCCCAAGATCAAGG - Intronic
1151065207 17:71140975-71140997 GAGCTAAAGGCGAAAGTTCATGG - Intergenic
1152398931 17:80052297-80052319 AACCTGGAGTCCAGTGTTCAAGG + Intronic
1152979844 18:266753-266775 CACCTGAGGTCAAGAGTTCAAGG - Intronic
1153131701 18:1861184-1861206 AACTTGGAGTCCAATGTTCAAGG + Intergenic
1153218150 18:2839039-2839061 GACTTGGAGTCCAATGTTCAAGG + Intergenic
1155154725 18:23148701-23148723 GACCTGAAGGCCCAGTTTCAAGG - Intronic
1155940861 18:31800611-31800633 AACTTGGAGTCCAATGTTCAAGG - Intergenic
1156573314 18:38282980-38283002 AACTTGGAGTCCAATGTTCAAGG - Intergenic
1157377317 18:47178293-47178315 AACTTGAAGTCCAACGTTCAAGG - Intergenic
1157377514 18:47179942-47179964 AACTTGGAGTCCAATGTTCAAGG + Intergenic
1157449389 18:47773839-47773861 GACCTGTTGTGCAAAGTGCATGG - Intergenic
1158076641 18:53537662-53537684 AACCTGGAGTCCAATGTTCGAGG + Intergenic
1159137715 18:64356401-64356423 GACTTCAAGCCCAAAGTACAAGG - Intergenic
1159377086 18:67605966-67605988 AACTTGGAGTCCAATGTTCAAGG - Intergenic
1159500760 18:69266161-69266183 CACCTGAGGTCAGAAGTTCAAGG + Intergenic
1159585843 18:70283008-70283030 GACCTGACATCCAAAGCTCTTGG - Intergenic
1159805605 18:72954816-72954838 GACATGTACTCAAAAGTTCATGG + Intergenic
1160884382 19:1338615-1338637 CACCTGAAGTCCCAAGTACTCGG + Intergenic
1162055800 19:8063221-8063243 CACCTGAAGTCAGGAGTTCAAGG + Intronic
1162256664 19:9496049-9496071 GACCTAAAGTCCAATATTAAAGG + Intronic
1162272397 19:9626981-9627003 GTCCTGAAGTCCTAATCTCAAGG + Intronic
1163185583 19:15636791-15636813 CACCTGAGGTCAAGAGTTCAAGG + Intronic
1163679183 19:18670929-18670951 CACCTGAGGTCAAGAGTTCAAGG - Exonic
1163705677 19:18811486-18811508 CACCTGAGGTCAGAAGTTCAAGG - Intergenic
1164880183 19:31726365-31726387 AACCTGGAGCCCAATGTTCAAGG - Intergenic
1165143901 19:33719470-33719492 GACACGAAGTCCAAAGCTGAGGG + Intronic
1165360414 19:35333134-35333156 GACCTGGATTCCAAAGTTATCGG + Intronic
1165640004 19:37376453-37376475 GACCTGAGGTCAGGAGTTCAAGG + Intronic
1167951508 19:53031450-53031472 CACCTGAAGTCAGGAGTTCAAGG - Intergenic
1167993361 19:53379781-53379803 CACTTGAGGTCAAAAGTTCAAGG + Intronic
925288088 2:2728964-2728986 GGCCTGGAGTCAAAAGCTCAGGG + Intergenic
925496565 2:4456714-4456736 AACATGAATTCCAAATTTCATGG - Intergenic
926404930 2:12541457-12541479 GACCTGAATGCCATAGTTTATGG + Intergenic
926859555 2:17294032-17294054 GACCTGAGGTCAGAAGTTCGAGG + Intergenic
927868433 2:26608017-26608039 CACCTGAAGTCAGGAGTTCAAGG + Intronic
928826279 2:35425334-35425356 AACCTGAAGTCTGATGTTCAAGG + Intergenic
928875452 2:36033418-36033440 GGCCTGAAAGCCAGAGTTCATGG + Intergenic
929888912 2:45903513-45903535 GATCTGAAGTTCAAATTTAACGG - Intronic
929918021 2:46152398-46152420 CACCTGAGGTCAAGAGTTCAAGG - Intronic
930362287 2:50396891-50396913 GACCTTAAGTCCAAATCTTAAGG - Intronic
930816009 2:55598589-55598611 GACCAAAACTGCAAAGTTCAAGG - Exonic
932611602 2:73203744-73203766 CACCTGAAGTCAGGAGTTCAAGG + Intronic
932870916 2:75396883-75396905 AACTTGAAGTCCGATGTTCAAGG + Intergenic
933523618 2:83407507-83407529 AACTTGGAGTCCAATGTTCAAGG - Intergenic
933554859 2:83819477-83819499 AACTTGAAGTCCAATGTTCGAGG - Intergenic
933951169 2:87331669-87331691 CACCTGAAGTCAAGAGTTCGAGG + Intergenic
934054120 2:88237544-88237566 AACTTGGAGTCCAATGTTCAAGG - Intergenic
935011241 2:99138136-99138158 GACCTGAAGTCAAATGTTACTGG - Intronic
935229615 2:101084328-101084350 CACCTGAGGTCAGAAGTTCAAGG + Intronic
935424785 2:102908823-102908845 AACCTGGAGTCCAATGTTCAAGG + Intergenic
935846918 2:107175830-107175852 GACCTGAGGTCAGGAGTTCAAGG - Intergenic
936328610 2:111526909-111526931 CACCTGAAGTCAAGAGTTCGAGG - Intergenic
936603164 2:113920139-113920161 CACCTGAAGTCAGGAGTTCAAGG - Intronic
936640840 2:114311507-114311529 AACTTCAAGTCCAATGTTCAAGG - Intergenic
938768375 2:134479216-134479238 GTCCTGCAGCCCAAACTTCAGGG + Intronic
939068655 2:137514405-137514427 AACTTGGAGTCCAATGTTCAAGG - Intronic
940870440 2:158855697-158855719 CACCTGAGGTCGGAAGTTCAAGG - Intronic
940943528 2:159590369-159590391 CACCTGAGGTCAAGAGTTCAAGG + Intronic
941474108 2:165926833-165926855 AACTTGGAGTCCAATGTTCAAGG - Intronic
943080233 2:183251164-183251186 AACTTGGAGTCCAAGGTTCAAGG + Intergenic
943468882 2:188267025-188267047 AACTTGGAGTCCAATGTTCAAGG + Intergenic
943490416 2:188547477-188547499 AACTTGAAGTCCAATCTTCAAGG + Intronic
943832121 2:192476580-192476602 AACCTGGAGTGCAACGTTCAAGG + Intergenic
943911385 2:193572452-193572474 GACCAGAAGTCCAAAATCAAGGG + Intergenic
944807564 2:203297621-203297643 CACCTGAGGTCCGAAGTTCGAGG + Intronic
944882036 2:204023047-204023069 GACCTGAAGTCAAAAGTAAAGGG - Intergenic
945052063 2:205833464-205833486 AACTTGGAGTCCAATGTTCAAGG - Intergenic
945606203 2:211935491-211935513 GTCCTGCAGTCCAAAGACCAGGG - Intronic
945725180 2:213466100-213466122 AACTTGGAGTCCAATGTTCAAGG - Intronic
1171014589 20:21528767-21528789 GGCCAGAAGTCCAAAGTCAAGGG + Intergenic
1173316208 20:41946395-41946417 CACTTGAAGTCAGAAGTTCAAGG - Intergenic
1173653490 20:44682722-44682744 GACCTGAAGTCCAATGATCCTGG + Intergenic
1175197170 20:57252178-57252200 GACATGAAATTCAAATTTCAAGG - Intronic
1175669814 20:60892512-60892534 GCCCTGAAGTCCTAGGCTCAGGG - Intergenic
1175860220 20:62146486-62146508 GACCAGAAGTCCCAAGTCCAGGG + Intronic
1178053807 21:28776751-28776773 AACTTGGAGTCCAATGTTCAAGG + Intergenic
1178069966 21:28953722-28953744 GACCTGAGGTGAGAAGTTCATGG + Intronic
1179646690 21:42780357-42780379 CACCTGAAGTCAGGAGTTCATGG + Intergenic
1180337968 22:11596997-11597019 GACGAGATGTCCAAAGATCAAGG - Intergenic
1181563693 22:23720761-23720783 CACCTGAAGTCAGGAGTTCAAGG - Intergenic
1181945160 22:26511194-26511216 AACTTGAAGTCCAATGTTCGAGG + Intronic
1182541089 22:31042510-31042532 CACCTGAGGTCAAGAGTTCAAGG + Intergenic
1183118457 22:35710946-35710968 TACCTGAGGTCAGAAGTTCAAGG + Intergenic
1183781950 22:40004519-40004541 CACCTGAAGTCAGGAGTTCAAGG - Intronic
949425857 3:3915029-3915051 AACCTGGAGTCCGATGTTCAAGG - Intronic
949569020 3:5273869-5273891 AACTTGGAGTCCAATGTTCAAGG - Intergenic
950512026 3:13435573-13435595 CACCTGAAGTCAGGAGTTCAAGG + Intergenic
951062012 3:18219917-18219939 GATCTGAAGTACAAAATTTAAGG + Intronic
951852796 3:27161784-27161806 CACCTGAGGTCAAGAGTTCAAGG + Intronic
952004141 3:28822795-28822817 GTCCTGGAGTCCAAAGCCCAGGG + Intergenic
953029098 3:39165463-39165485 GCCCAGAAGCCAAAAGTTCAGGG + Intergenic
956422578 3:69100143-69100165 CACCTGAGGTCAAGAGTTCAAGG - Intronic
956444917 3:69316901-69316923 GACCTGAGGTCAGGAGTTCAAGG + Intronic
956913534 3:73846585-73846607 GGCCAGAAGTCCAAAAGTCAAGG + Intergenic
957246506 3:77723058-77723080 AATCTGGAGTCCAATGTTCAAGG + Intergenic
957352671 3:79046579-79046601 AACTTGGAGTCCAATGTTCAAGG + Intronic
957410925 3:79838605-79838627 GCCAAGAAGTCCAAAGTTGAGGG - Intergenic
957683760 3:83473445-83473467 AACTTGGAGTCCAAAGTTCGAGG - Intergenic
957819514 3:85353178-85353200 GACTAGAATTCCAAAGCTCAAGG + Intronic
958499717 3:94889508-94889530 AAACTGGAGTCCAATGTTCAAGG - Intergenic
958548363 3:95587090-95587112 GACCTGAAGTCCGATGTTCAAGG - Intergenic
958599582 3:96278229-96278251 GACTTCAAGTCTCAAGTTCAGGG + Intergenic
958778122 3:98509842-98509864 AACTTGGAGTCCAATGTTCAAGG + Intronic
960223232 3:115141970-115141992 AATCTGAAGTGCAGAGTTCATGG - Intronic
961746459 3:129066573-129066595 CACCTGAAGTCAGGAGTTCAAGG + Intergenic
962103360 3:132365766-132365788 CACCTGAAGTCAGGAGTTCATGG + Intronic
963463924 3:145653544-145653566 CACCTGAGGTCAGAAGTTCAAGG + Intergenic
964423420 3:156528774-156528796 CTCCTGAAGCACAAAGTTCAAGG + Intronic
964523135 3:157588091-157588113 AACTTGGAGTCCAATGTTCAAGG - Intronic
964808633 3:160638846-160638868 AACTTGAAGTCCAATGTTCGAGG - Intergenic
964904143 3:161697367-161697389 GGCCAGAAGTCCAAAATTAAAGG + Intergenic
965191030 3:165530122-165530144 AACTTGGAGTCCAAAGTTCAAGG - Intergenic
966044002 3:175528292-175528314 AACTTGGAGTCCAACGTTCAAGG + Intronic
966371778 3:179258102-179258124 CACCTGAGGTCAGAAGTTCAAGG - Intronic
967602043 3:191401719-191401741 AACCTGAAGTCCAATGTCCAGGG + Intergenic
967907437 3:194513288-194513310 GGCCTGAAGTCCAACATTTAAGG + Intergenic
968327783 3:197835400-197835422 CACCTGAAGTCAGGAGTTCAAGG - Intronic
968812888 4:2808128-2808150 GGCCAGAAGTCCAAAGCTGAGGG + Intronic
968906432 4:3454169-3454191 AACTTGAAGTCCAATGTACAAGG - Intergenic
968919088 4:3513431-3513453 CACCTGTAGTCCTAAGTACATGG - Intronic
969452850 4:7284792-7284814 GGCCAGAAGTCTAAAATTCAGGG + Intronic
969861100 4:10035871-10035893 GTCCTAAAGTCCAAAGGTCAGGG - Intronic
969914275 4:10474521-10474543 GACTTAAAGTTCAATGTTCAAGG + Intergenic
969966450 4:11001680-11001702 AACCTGGAGCCCAATGTTCAAGG - Intergenic
969982577 4:11173320-11173342 AACCTGGAGTCTAAGGTTCAAGG - Intergenic
970174917 4:13329951-13329973 GAACCAAAGTCCCAAGTTCAAGG + Intergenic
970359759 4:15297209-15297231 GACCTGCTGTACAAAGTTGAGGG - Intergenic
970751850 4:19372876-19372898 AAACTGGAGTCCAATGTTCAAGG - Intergenic
970858300 4:20673574-20673596 AACTTGGAGTCCAATGTTCAAGG - Intergenic
971100684 4:23463763-23463785 AACTTGGAGTCCAATGTTCAAGG + Intergenic
971209329 4:24600713-24600735 AACTTAAAGTCCAATGTTCAAGG - Intergenic
971687056 4:29784463-29784485 AACCTGGAGTCCAATGTTCGAGG + Intergenic
971727556 4:30333180-30333202 AACTTGGAGTCCAATGTTCAAGG - Intergenic
971857345 4:32060224-32060246 AACCTGGAGTCTAATGTTCAGGG + Intergenic
972514294 4:39797812-39797834 GACCTGAGGTCAGGAGTTCAAGG - Intergenic
972709079 4:41575836-41575858 GACCTGAAGCCCAAAGTATAGGG - Intronic
972825394 4:42753062-42753084 AACGTGGAGTCCAATGTTCAAGG + Intergenic
973027265 4:45288284-45288306 AACCTGGAGTCCAATGTTCAAGG - Intergenic
974405510 4:61463184-61463206 CATCTGAAGTTCAAATTTCACGG + Intronic
974522618 4:63004183-63004205 CACCTGAGGTCAGAAGTTCAAGG + Intergenic
974524641 4:63033191-63033213 CACCTAAATTCCTAAGTTCATGG - Intergenic
974584691 4:63856674-63856696 CACTTGAAGTCAAAATTTCAAGG - Intergenic
975350956 4:73345779-73345801 GCCCTGAAGTCCAAAGGTAGAGG + Intergenic
976123083 4:81804300-81804322 GGCCTGAAGGCCCAAGTTCTTGG + Intronic
976280611 4:83323307-83323329 CACCCAAAGTCCATAGTTCACGG - Intronic
976652607 4:87452219-87452241 AACCTGAAGTCAGGAGTTCAAGG - Intronic
976949518 4:90812106-90812128 AACTTGGAGTCCAATGTTCAAGG + Intronic
977072233 4:92405981-92406003 AACTTGGAGTCCAATGTTCAAGG + Intronic
977601941 4:98943028-98943050 AACCTGGAGTCCAATGTTCAAGG - Intergenic
978507417 4:109474641-109474663 CACCTGAGGTCAAAAGTTCGAGG - Intronic
978996607 4:115163588-115163610 GTCTGAAAGTCCAAAGTTCATGG - Intergenic
981290810 4:143072195-143072217 AACATGGAGTCCAATGTTCAAGG + Intergenic
981605538 4:146536487-146536509 AACTTGAAGTCCAATGTTCGAGG + Intergenic
982774036 4:159423995-159424017 GCCCTGGAGCACAAAGTTCAAGG + Intergenic
982851693 4:160325549-160325571 AACTTGGAGTCCAAGGTTCAAGG + Intergenic
983052140 4:163061018-163061040 GAGCTGAAGTCCAAATCTCAAGG - Intergenic
983233824 4:165156380-165156402 GACCTTAAGGCCAGAGCTCAAGG - Intronic
983761397 4:171411152-171411174 CACCTGAAGTCAGGAGTTCAAGG + Intergenic
984452010 4:179914330-179914352 AACTTGGAGTCCAATGTTCAAGG - Intergenic
986921153 5:12683546-12683568 AACCTGAAGTCTAATGCTCAAGG - Intergenic
987153525 5:15064278-15064300 AACTTGGAGTCCAATGTTCAAGG - Intergenic
987336178 5:16899777-16899799 CACCTGATGTCAAGAGTTCAGGG + Intronic
987359259 5:17092122-17092144 CACCTGAGGTCCAGAGTTCAAGG - Intronic
988104795 5:26730804-26730826 AACTTGGAGTCCAATGTTCAAGG + Intergenic
988151612 5:27389590-27389612 GAGCTGAGGTCCAAAATTTAAGG - Intergenic
988393756 5:30669837-30669859 AACTTGGAGTCCAATGTTCAAGG - Intergenic
988475724 5:31583508-31583530 CACCTGAAGTCAGGAGTTCAAGG + Intergenic
989000268 5:36752496-36752518 AACTTGGAGTCCAATGTTCAAGG - Intergenic
989224933 5:39016007-39016029 TTTATGAAGTCCAAAGTTCATGG + Intronic
989989491 5:50744239-50744261 GGTCTGAACTCCCAAGTTCATGG - Intronic
990198449 5:53344471-53344493 AACTTGGAGTCCGAAGTTCAAGG - Intergenic
990591439 5:57269177-57269199 GACATTAAGTCCAAATTTGAGGG - Intergenic
991102620 5:62809804-62809826 CACCTGAAGTCAGGAGTTCAAGG + Intergenic
991341625 5:65616938-65616960 CACCTGAAGTCAGGAGTTCAAGG - Intronic
992417698 5:76567604-76567626 GACTTGAAGTCCAAATATTATGG + Intronic
992637636 5:78740163-78740185 AACCTGAAGTCAGAACTTCATGG - Intronic
993203724 5:84850175-84850197 AACCTGGAGTCCCATGTTCAAGG - Intergenic
995287937 5:110413262-110413284 AACTTGGAGTCCAATGTTCAAGG - Intronic
995718320 5:115102670-115102692 AACTTGGAGTCCAATGTTCAAGG + Intergenic
995981742 5:118112630-118112652 GACCTGAGGTCAGGAGTTCAAGG + Intergenic
996491249 5:124100415-124100437 CACCTGAGGTCGGAAGTTCAAGG + Intergenic
997344464 5:133176674-133176696 GACTTGAAGTCCCAGGGTCAAGG + Intergenic
998116850 5:139544507-139544529 CACCTGAGGTCAAGAGTTCAAGG - Intronic
998158623 5:139800321-139800343 CACCTGAAGTTCAGAGTTCATGG - Intronic
998290780 5:140912051-140912073 AACTTGGAGTCCAATGTTCAAGG + Intronic
998427219 5:142039213-142039235 CACCTGAGGTCAGAAGTTCAAGG - Intergenic
998435781 5:142107968-142107990 GACATGAAGTCAAAACTTGAAGG - Intergenic
998591361 5:143482207-143482229 GATCTGAGGTACAAAGTTCCTGG - Intergenic
999569542 5:152903621-152903643 CACCTGAAGTCAGGAGTTCAAGG + Intergenic
999641771 5:153679747-153679769 GACCTGAAGGCCAGAGGTGAAGG - Intronic
1000256659 5:159545517-159545539 GACCTAAAATGCAAAGTTCATGG - Intergenic
1001092867 5:168754155-168754177 ATGCTGAAGACCAAAGTTCAGGG - Intronic
1001121237 5:168981907-168981929 GACCTGTAATCAACAGTTCATGG - Intronic
1001242181 5:170079364-170079386 GCTCTGAAGTGCAAAGGTCAGGG - Intronic
1002041696 5:176519487-176519509 CACCTGATGTCAGAAGTTCAAGG - Intergenic
1004027638 6:11834630-11834652 TACCTGAATTCCAAAATTCAAGG - Intergenic
1004088489 6:12474831-12474853 GACTTGAACTCAGAAGTTCAAGG + Intergenic
1004835932 6:19531645-19531667 GTCCTGGAGTCCAAAGGCCAGGG - Intergenic
1005136764 6:22577715-22577737 GTCCTGAAGCCCATATTTCATGG + Intergenic
1005892187 6:30148952-30148974 CACCTGAGGTCAGAAGTTCAAGG - Intergenic
1006061860 6:31427178-31427200 AACTTGGAGTCCAATGTTCAAGG - Intergenic
1006801462 6:36762560-36762582 GACCTGAGGTCCTGAGTTCGAGG - Intronic
1007042261 6:38733565-38733587 GAACAGAAGTACAGAGTTCAGGG + Intronic
1007385794 6:41519525-41519547 GGCCTTCTGTCCAAAGTTCAAGG + Intergenic
1008820719 6:55627757-55627779 AACCTGGAGTCCAATGTTCAAGG - Intergenic
1010328453 6:74592799-74592821 AACCTGGAGTCCAATGTTCAAGG - Intergenic
1010818966 6:80391020-80391042 AACTTGGAGTCCAATGTTCAAGG - Intergenic
1011003442 6:82617556-82617578 GGCCAGAAGTCCAAAAATCAAGG + Intergenic
1011026334 6:82873401-82873423 AACTTGGAGTCCAATGTTCAAGG - Intergenic
1011039021 6:83010694-83010716 GAATTGGAGTCCAATGTTCAAGG + Intronic
1011039796 6:83016819-83016841 AACTTGGAGTCCAATGTTCAAGG + Intronic
1013248010 6:108306120-108306142 AACCTGAAGTCAGGAGTTCAAGG - Intronic
1014417320 6:121198023-121198045 AACTTGGAGTCCAATGTTCAAGG - Intronic
1014765761 6:125404430-125404452 GACTTGAAGAACAGAGTTCAAGG - Intergenic
1016038877 6:139411389-139411411 AACTTGGAGTCCAATGTTCAAGG + Intergenic
1016908674 6:149176128-149176150 AACCTGGAGTCCAACCTTCAAGG + Intergenic
1016932084 6:149421642-149421664 GACCGGAAGACCAAAGTACCAGG - Intergenic
1017356314 6:153513416-153513438 AACCTGGAGTCTAATGTTCAAGG + Intergenic
1018666387 6:166142060-166142082 AACCTGAAGTCAGGAGTTCAAGG + Intergenic
1018681861 6:166271399-166271421 GTCCTGAAGCCCTAAGTTCCGGG - Intergenic
1018833957 6:167469567-167469589 GACCTCATGTCCAATCTTCAGGG - Intergenic
1019016758 6:168885548-168885570 GATCTGAATTCCAAAGATCTGGG + Intergenic
1020179709 7:5912616-5912638 CACCTGAAGTCAGGAGTTCAAGG - Intronic
1020303228 7:6812268-6812290 CACCTGAAGTCAGGAGTTCAAGG + Intronic
1020742866 7:12043851-12043873 AACTTGGAGTCCAATGTTCAAGG + Intergenic
1020943298 7:14567823-14567845 CACCTGAAGTCAGGAGTTCAAGG - Intronic
1021528097 7:21611239-21611261 GTCCTGGAGTCCAAAGTCCAGGG - Intronic
1022121864 7:27316215-27316237 GACTTGAACTCCAGGGTTCAAGG + Intergenic
1022276310 7:28858624-28858646 AACTTGAAGTCCGATGTTCAAGG + Intergenic
1023439104 7:40168533-40168555 GGCCTGCAGTGCAAAGTGCAGGG + Intronic
1025098622 7:56116728-56116750 TACTTGAACTCCAAGGTTCATGG + Intergenic
1026038266 7:66845311-66845333 TACTTGAACCCCAAAGTTCAAGG + Intergenic
1026324285 7:69295471-69295493 AACTTGGAGTCCAATGTTCAAGG + Intergenic
1027498047 7:78912594-78912616 AACTTGGAGTCCAATGTTCAAGG - Intronic
1028168685 7:87569112-87569134 CACCTGAGGTCAGAAGTTCAAGG + Intronic
1028447836 7:90945132-90945154 ACCCTGAAGTCCAAATTCCAAGG - Intronic
1029177156 7:98672893-98672915 GACCTGACCTCCAAAGTCCATGG - Intergenic
1030024089 7:105305219-105305241 CACCTGAAGTCAAGAGTTCAAGG + Intronic
1030394230 7:108965579-108965601 AACCTGGAATCCAATGTTCAAGG + Intergenic
1030579351 7:111333780-111333802 AACTTGGAGTCCAATGTTCAAGG - Intronic
1031176764 7:118362340-118362362 AACTTGGAGTCCAATGTTCAAGG - Intergenic
1031492942 7:122411436-122411458 TACCTGAAGTCAGGAGTTCAAGG - Intronic
1031810690 7:126364403-126364425 AACTTGAAGTCCAATGTTCGAGG - Intergenic
1032007186 7:128312198-128312220 CACCTGAGGTCAAGAGTTCAAGG + Intronic
1032372722 7:131375029-131375051 GACTTGAGGCCCAGAGTTCAAGG - Intronic
1033157108 7:138966516-138966538 AACCTGAAGTTCGATGTTCAAGG + Intronic
1033194255 7:139314064-139314086 CACCTGAAGTCAGGAGTTCAAGG - Intergenic
1033607093 7:142935644-142935666 GAGCTGAGATCCCAAGTTCATGG - Intergenic
1033784582 7:144715782-144715804 AACTTGGAGTCCAATGTTCAAGG + Intronic
1034008641 7:147503999-147504021 AAGCTGAGGTTCAAAGTTCATGG + Intronic
1034636190 7:152569082-152569104 GACCTGAGGTTCAGAGTTTAAGG + Intergenic
1034647096 7:152657507-152657529 CACCTGAGGTCAGAAGTTCAAGG - Intronic
1035369352 7:158369135-158369157 AACTTGGAGTCCAATGTTCAAGG - Intronic
1036976932 8:13424268-13424290 CACCTGAAGTCAGGAGTTCAAGG + Intronic
1037169136 8:15869154-15869176 AACTTGGAGTCCAATGTTCAAGG - Intergenic
1037520540 8:19676421-19676443 TATCTGAAATCCAAAATTCACGG + Intronic
1038145241 8:24888973-24888995 GGCCAGAAGTCCAAACATCAAGG + Intergenic
1038277117 8:26130596-26130618 CAACTCAAGTCCAAAGTCCATGG - Intergenic
1038522635 8:28246470-28246492 GACCTTAAGTGCAAAGACCAAGG + Intergenic
1038660508 8:29492834-29492856 AACCTGAAGTCCAATGTCCAAGG + Intergenic
1038758520 8:30364633-30364655 CACCTGAGGTCAGAAGTTCAAGG + Intergenic
1038805138 8:30783490-30783512 GACTTGAGTCCCAAAGTTCAAGG - Intronic
1039396278 8:37227867-37227889 GAACTGAAGTCATAGGTTCATGG + Intergenic
1039749303 8:40462441-40462463 TACCTGAAATACAAAGCTCAGGG + Intergenic
1039872473 8:41558056-41558078 AACCTGGAGTCCAATGTTCCAGG - Intergenic
1041219766 8:55637794-55637816 TACCTGAAATTCAAAATTCATGG + Intergenic
1042360193 8:67874098-67874120 CACCTGAAGTCAGGAGTTCAAGG + Intergenic
1043326874 8:79063007-79063029 TACCTGAAGTCAGGAGTTCAAGG + Intergenic
1043363592 8:79504272-79504294 AACCTGGAGTCCTATGTTCAAGG - Intergenic
1043682616 8:83048708-83048730 GCCATTGAGTCCAAAGTTCAGGG + Intergenic
1043774269 8:84245123-84245145 GCCCTTCAGTGCAAAGTTCAAGG - Intronic
1044237540 8:89848933-89848955 CAGCTTGAGTCCAAAGTTCATGG - Intergenic
1044578855 8:93802116-93802138 AAGCAGAGGTCCAAAGTTCAGGG + Intronic
1044633865 8:94303266-94303288 GACTTGGAGTCCAATGTTCAAGG + Intergenic
1044933373 8:97271183-97271205 GACCTAAAGGCCAAAGGTGAGGG + Intergenic
1045708360 8:104954608-104954630 GTCAGGAAGTCCAAAGTCCAGGG + Intronic
1045932742 8:107646310-107646332 AACTTGGAGTCCAATGTTCAAGG + Intergenic
1046188033 8:110748586-110748608 AACTTGAAGTCCAATGTTCAAGG + Intergenic
1046962909 8:120128514-120128536 CACCTGAGGTCAAGAGTTCAAGG + Intronic
1047054057 8:121144852-121144874 AACTTGGAGTCCAATGTTCAAGG + Intergenic
1047580271 8:126206375-126206397 AACTTGGAGTCCAATGTTCAAGG - Intergenic
1047618477 8:126582698-126582720 GATGAGAAGTCCAAAGGTCAAGG - Intergenic
1048236795 8:132698860-132698882 CACCTGAAGTCAGGAGTTCAAGG + Intronic
1048346466 8:133579311-133579333 CACCTGAGGTCAAGAGTTCAAGG - Intergenic
1048753965 8:137713867-137713889 GACCTGGAGTCCAGTGGTCAAGG - Intergenic
1048887121 8:138917577-138917599 CACCTGAAGTCAGGAGTTCAAGG - Intergenic
1049141291 8:140956841-140956863 CACCTGAGGTCAGAAGTTCAAGG + Intronic
1050168624 9:2792315-2792337 AACTTGGAGTCCAATGTTCAAGG - Intronic
1050888454 9:10794115-10794137 AACCTGGAGTCTGAAGTTCAAGG + Intergenic
1050975780 9:11936398-11936420 GACCTGGAGTCTGATGTTCAAGG + Intergenic
1051036780 9:12756657-12756679 AACTTGGAGTCCAATGTTCAAGG - Intergenic
1051399312 9:16662515-16662537 CACCTGAGGTCAAGAGTTCAAGG + Intronic
1051407157 9:16749819-16749841 AATTTGAAGTCCAAATTTCAAGG - Intronic
1051826619 9:21228215-21228237 AACCTAGAGGCCAAAGTTCAAGG - Exonic
1051829780 9:21262917-21262939 GCCCTGGAGTCCAAAGATCGGGG - Intergenic
1052227174 9:26103841-26103863 AACTTGAAGTCCAATGTTCAAGG - Intronic
1052715590 9:32112486-32112508 GTCCAGAAGTCCAAAATTAAGGG - Intergenic
1053130108 9:35609765-35609787 GTCCTGAAGGCCAAAGTTGGAGG - Exonic
1055097950 9:72433879-72433901 CACCTGAGGTCAGAAGTTCAAGG - Intergenic
1055913511 9:81376793-81376815 TAACTCAAGTCCAAAGCTCATGG + Intergenic
1056165464 9:83936862-83936884 GACATGAACTCCTACGTTCAAGG + Intergenic
1056295855 9:85192410-85192432 CACCTGAAGTCAGGAGTTCAAGG + Intergenic
1056433467 9:86551815-86551837 GACCTGAAGTCCATAGTTTAGGG + Intergenic
1059135130 9:111798378-111798400 CACCTGAGGTCAGAAGTTCAAGG + Intergenic
1059468536 9:114485470-114485492 CACCTGAAGTCAGGAGTTCAAGG + Intronic
1059592551 9:115677837-115677859 AACCTGGAGTCCAATGTTCAAGG + Intergenic
1059641107 9:116217957-116217979 AAGATGAAGTACAAAGTTCATGG + Intronic
1059880979 9:118688416-118688438 CACTTGGAGTCCAATGTTCAAGG - Intergenic
1060806703 9:126582218-126582240 GACCAGAAGTCCAAAATAAAAGG - Intergenic
1061807611 9:133145113-133145135 GGCCAGAAGTCCAAAATCCAGGG - Intronic
1185744617 X:2562526-2562548 AACCTGGAGTCCAATGTTCAAGG + Intergenic
1186055284 X:5643425-5643447 AACCTGGAGTCCGACGTTCAAGG + Intergenic
1186558065 X:10581836-10581858 GAAGTGAAGCCCCAAGTTCATGG - Intronic
1186657599 X:11631827-11631849 GACATGAAATTCAAATTTCAAGG - Intronic
1187339122 X:18405679-18405701 AACTTGGAGTCCAATGTTCAAGG + Intergenic
1187651867 X:21418723-21418745 TACCTCAAGTCCAAAAGTCAAGG - Intronic
1188098806 X:26056774-26056796 CACTTGAAGTCAAGAGTTCAAGG + Intergenic
1188151335 X:26679785-26679807 AACTTGGAGTCCAATGTTCAAGG - Intergenic
1188586864 X:31787151-31787173 CACCTGAGGTCCGGAGTTCAAGG + Intronic
1189747684 X:44186897-44186919 GACTTGAAGCCAAGAGTTCAAGG + Intronic
1190275418 X:48896239-48896261 CACCTGAGGTCCAGAGTTCAAGG + Intronic
1190431182 X:50379096-50379118 CACCTGAGGCCAAAAGTTCAAGG + Intronic
1190636371 X:52438575-52438597 AACTTGGAGTCCAATGTTCAAGG + Intergenic
1190703197 X:53003557-53003579 CACTTGAAGTCAAGAGTTCAAGG - Intergenic
1190940401 X:55034928-55034950 AACTTGGAGTCCAATGTTCAAGG + Intergenic
1191709874 X:64138031-64138053 GAGCTGAAGTCCAAGATTGATGG - Intergenic
1191952213 X:66604800-66604822 CAGCTGAAGACCAAAGTTCAAGG - Intronic
1192067043 X:67896345-67896367 GACGTGAACTGCAAAGTTAAAGG - Intergenic
1192718332 X:73666383-73666405 AACTTGGAGTCCAATGTTCAAGG + Intronic
1193253733 X:79323078-79323100 GTCTTGAACTCCCAAGTTCAAGG + Intergenic
1194032433 X:88833303-88833325 AACGTGGAGTCCAATGTTCAAGG + Intergenic
1194208847 X:91044146-91044168 AACTTGGAGTCCAATGTTCAAGG - Intergenic
1194549701 X:95281692-95281714 GACATGAAGTTCAGAGTTTAGGG - Intergenic
1194775258 X:97955333-97955355 CACTTGAACTCCAGAGTTCAAGG - Intergenic
1194812068 X:98399283-98399305 GCCAGGAAGTCCAAAGATCAAGG + Intergenic
1194881911 X:99263402-99263424 AACTTGAAGTCCGATGTTCAAGG + Intergenic
1194987359 X:100505379-100505401 AACTTGGAGTCCAATGTTCAAGG - Intergenic
1196372343 X:114993975-114993997 AACTTGAAGTCCGATGTTCAAGG + Intergenic
1196374231 X:115014452-115014474 GATCAGAAGTTCAAAGTTCCTGG - Exonic
1197074118 X:122335230-122335252 AACTTGGAGTCCAATGTTCAAGG + Intergenic
1197245529 X:124162770-124162792 AACCTGGAGTCCAATGTTCGAGG + Intronic
1198074552 X:133182049-133182071 CCTCTGAAGTCCAGAGTTCAGGG - Intergenic
1198371915 X:135997624-135997646 CACCTGAAGCCAAGAGTTCAAGG - Intronic
1198703596 X:139422916-139422938 GTCTTGAAGTCCAAATTTGAAGG + Intergenic
1198786071 X:140289683-140289705 AACTTGGAGTCCAATGTTCAAGG - Intergenic
1199932193 X:152534614-152534636 AACCTGGAGTCCAATGTGCAAGG + Intergenic