ID: 1129767772

View in Genome Browser
Species Human (GRCh38)
Location 15:78181110-78181132
Sequence GCTCACAGAACCCTGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129767768_1129767772 3 Left 1129767768 15:78181084-78181106 CCTCAATGGCTGTCGCCTTGCTT 0: 1
1: 0
2: 1
3: 4
4: 103
Right 1129767772 15:78181110-78181132 GCTCACAGAACCCTGGTGGCAGG 0: 1
1: 0
2: 0
3: 15
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129767772 Original CRISPR GCTCACAGAACCCTGGTGGC AGG Intronic