ID: 1129769626

View in Genome Browser
Species Human (GRCh38)
Location 15:78194712-78194734
Sequence TCCACAGCGCCTCCTCTGTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 211}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129769618_1129769626 -2 Left 1129769618 15:78194691-78194713 CCCGCCCATCGGCCCGAGTCGTC 0: 1
1: 0
2: 1
3: 1
4: 25
Right 1129769626 15:78194712-78194734 TCCACAGCGCCTCCTCTGTGGGG 0: 1
1: 0
2: 2
3: 14
4: 211
1129769621_1129769626 -7 Left 1129769621 15:78194696-78194718 CCATCGGCCCGAGTCGTCCACAG 0: 1
1: 0
2: 0
3: 2
4: 27
Right 1129769626 15:78194712-78194734 TCCACAGCGCCTCCTCTGTGGGG 0: 1
1: 0
2: 2
3: 14
4: 211
1129769620_1129769626 -6 Left 1129769620 15:78194695-78194717 CCCATCGGCCCGAGTCGTCCACA 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1129769626 15:78194712-78194734 TCCACAGCGCCTCCTCTGTGGGG 0: 1
1: 0
2: 2
3: 14
4: 211
1129769619_1129769626 -3 Left 1129769619 15:78194692-78194714 CCGCCCATCGGCCCGAGTCGTCC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1129769626 15:78194712-78194734 TCCACAGCGCCTCCTCTGTGGGG 0: 1
1: 0
2: 2
3: 14
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129769626 Original CRISPR TCCACAGCGCCTCCTCTGTG GGG Exonic
900322888 1:2093755-2093777 TACACAGCACGTCCTCTGTGAGG - Intronic
902462955 1:16592891-16592913 TCCAGAGCTCTTCCTCTATGTGG + Intronic
902717010 1:18279913-18279935 TGCACAGCGCCTGCTAAGTGGGG + Intronic
903158564 1:21467841-21467863 TCCAGAGCTCTTCCTCTATGTGG - Intronic
903287275 1:22285088-22285110 TCCAGACCGCCTCCTCCATGCGG - Intergenic
905325899 1:37151837-37151859 CCCTCAGACCCTCCTCTGTGAGG + Intergenic
909925107 1:81429665-81429687 TCCACAGAGCCTGCACTGTTTGG - Intronic
910209071 1:84775400-84775422 TCCATAGCGCCACCTCTCAGCGG + Intergenic
911101780 1:94101320-94101342 CCGACAGCACCCCCTCTGTGGGG + Intronic
913640118 1:120804698-120804720 TCCAAAGCTCTTCCTCTATGTGG - Intergenic
913991060 1:143612286-143612308 TCCAAAACTCTTCCTCTGTGTGG + Intergenic
914212394 1:145591930-145591952 TCCAAAGCTCTTCCTCTATGTGG + Intergenic
914278356 1:146145639-146145661 TCCAAAGCTCTTCCTCTATGTGG + Intronic
914539403 1:148596587-148596609 TCCAAAGCTCTTCCTCTATGTGG + Intronic
914627276 1:149475041-149475063 TCCAAAGCTCTTCCTCTATGTGG - Intergenic
914940389 1:152017763-152017785 TCCAAAGCTCTTCCTCTATGTGG - Intergenic
917526816 1:175795518-175795540 GCCACAGCGTCTCCTCAGAGAGG - Intergenic
920413639 1:205782827-205782849 TGCACACCACATCCTCTGTGTGG - Intergenic
922460578 1:225811786-225811808 TCCTCAGCGCCTCCTAGGTGTGG - Intronic
1062811379 10:468963-468985 TCCACAGCTCCTTCTCTTTAGGG - Intronic
1062824329 10:557185-557207 TCCACACCGGTCCCTCTGTGGGG - Intronic
1064943999 10:20768006-20768028 GCCACAGCACCTGCTCTCTGGGG + Intergenic
1065628817 10:27657310-27657332 ACCACAGTCTCTCCTCTGTGGGG + Intergenic
1066296026 10:34055415-34055437 CTCACAGCGCCTCCTCTGCCTGG + Intergenic
1069850231 10:71399360-71399382 TCCACAGTGCCTTCTCTAAGAGG + Intronic
1070319549 10:75344195-75344217 GCCACAGGGGCTCCTCTATGAGG + Intergenic
1070840797 10:79486671-79486693 TCCACAGCGCATACTCAGAGGGG - Intergenic
1071775745 10:88786131-88786153 TCCATGGCGCCTCCTCTCTGTGG - Intergenic
1073107121 10:101038636-101038658 TCCACAGCGCCGCCCCTGGCTGG + Exonic
1077306217 11:1869781-1869803 CCCACGCCCCCTCCTCTGTGGGG - Intronic
1077943107 11:6864650-6864672 TGCACATCCCCTCCTCTGTCTGG - Intergenic
1078241574 11:9535273-9535295 TCCACAGCGCCTCCTGCTGGTGG - Intergenic
1078457126 11:11484015-11484037 GACACAGCACCTACTCTGTGCGG + Intronic
1079089771 11:17472719-17472741 TCAGCAGCCCCTCCTGTGTGTGG - Intronic
1079241017 11:18722027-18722049 TCCTCACGACCTCCTCTGTGGGG + Exonic
1079936141 11:26618777-26618799 TCCACAGTGCTTCCTGTGTCTGG + Intronic
1080942572 11:36936341-36936363 TCAAAAGCGACTCCTCTATGAGG - Intergenic
1081493143 11:43582209-43582231 TCCAAAGCTCCTTCTCTGCGGGG - Intronic
1081871935 11:46386964-46386986 TCCACAGCTCCTCCTGTGGCTGG - Intergenic
1081969579 11:47188312-47188334 TCCACATCCCCTTCTCTTTGTGG - Intergenic
1084029795 11:66474584-66474606 TCCAGAGCGTCAACTCTGTGGGG + Intronic
1084323793 11:68387725-68387747 TCCACTGCGCCTCCTCCATCAGG - Intronic
1084623737 11:70292342-70292364 TCCACTCCGCCTCCCCTGTGTGG + Intronic
1085047895 11:73363917-73363939 TCTACTGTCCCTCCTCTGTGTGG + Intronic
1097044348 12:56176326-56176348 TCCACAGCTTCCCCTCTCTGGGG - Intronic
1104066359 12:125310325-125310347 TCCACACCACCACCTCTGTCCGG - Intronic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1110219867 13:73060516-73060538 TACCCAGCGCCTACTCCGTGGGG + Intronic
1112383868 13:98919651-98919673 ACCACAGAGCCTTCTGTGTGAGG + Intronic
1112583338 13:100695201-100695223 TCCTCAGAGCCTCCTCTGCCCGG - Intergenic
1114533222 14:23408193-23408215 TCCACAGAGCCCCCACCGTGAGG - Intronic
1115618875 14:35121764-35121786 TCCACTCCGCCTCCTTTGTCGGG + Intronic
1117565562 14:56990927-56990949 CCCTCAGCGCCTCCTCTGCCTGG + Intergenic
1117992113 14:61444349-61444371 GCCACAGCCCCACCTCTCTGTGG + Intronic
1118602212 14:67478737-67478759 GACCCAGCTCCTCCTCTGTGAGG + Intronic
1118735005 14:68694917-68694939 AGCCCAGCGCCTCCTGTGTGGGG - Intronic
1122409947 14:101520763-101520785 TCCCGAGCGCCTGCTGTGTGCGG - Intergenic
1122612770 14:102997095-102997117 GACACAGCCCCTCCTGTGTGGGG - Intronic
1122985005 14:105208000-105208022 TCCACACCGCACCCTCTCTGGGG + Intergenic
1125751349 15:42031457-42031479 TGCACAGAGCCTCCTCTCTTTGG + Intronic
1128455599 15:67829738-67829760 CCCCCAACCCCTCCTCTGTGAGG - Intronic
1128902411 15:71436590-71436612 TTCACAGCACCTCATCTGTAGGG + Intronic
1129265216 15:74389704-74389726 ACCACAGCGGGGCCTCTGTGTGG + Intergenic
1129769626 15:78194712-78194734 TCCACAGCGCCTCCTCTGTGGGG + Exonic
1130108093 15:80943943-80943965 CCCACATCGCCTCCTCGGTGAGG + Intronic
1132416240 15:101621023-101621045 TCCACAGGGGCTTCTCCGTGTGG - Intergenic
1132539184 16:500306-500328 TCCACAGCTCCCTCTCTGGGAGG + Intronic
1133259700 16:4540275-4540297 TCAGCATCGCCTCCTCTGAGAGG - Intergenic
1134883841 16:17772344-17772366 TCCAAAGCGTCACCTTTGTGGGG - Intergenic
1134883935 16:17773210-17773232 TCCAAAGTGTCACCTCTGTGGGG + Intergenic
1136617837 16:31409592-31409614 TCAATGTCGCCTCCTCTGTGAGG - Intronic
1138294869 16:55877624-55877646 TGCACAGGACCTACTCTGTGAGG + Intronic
1141460948 16:84178629-84178651 TCCGCTGCGCCTCAGCTGTGGGG - Exonic
1142347905 16:89565698-89565720 TCCACAGCGCCCCCTAGGTCAGG - Exonic
1143362734 17:6384714-6384736 CCCACATCCTCTCCTCTGTGGGG + Intergenic
1143733532 17:8894717-8894739 TCCCCAGCCCCTGCTCTGTGAGG - Intronic
1144672538 17:17141080-17141102 TCCACCACGACTCCTCTGTCTGG + Intronic
1145868120 17:28253603-28253625 GCCACAGAGCCTCAGCTGTGTGG + Intergenic
1145883848 17:28369567-28369589 TGCACAGCTCCTCCTCTGCTGGG + Exonic
1147923987 17:43935601-43935623 GCCACAGAGCCTCAGCTGTGTGG - Intergenic
1148847649 17:50538630-50538652 TCCTCAGGCCCTCCTGTGTGAGG - Intronic
1150220236 17:63491937-63491959 TCTACAGGGCCCCCTCTGTTGGG + Intronic
1151216236 17:72578522-72578544 TCCTCAGCGCTTCCTCCTTGGGG - Intergenic
1152036960 17:77879549-77879571 TCCACGCCACCTTCTCTGTGGGG - Intergenic
1152572654 17:81127421-81127443 TCCCCATCGCCTCCTCTGGAAGG + Intronic
1152614215 17:81330475-81330497 CCAACAGCGCCTCCTCTGTGAGG - Exonic
1155120650 18:22816107-22816129 TCTCCAGGGCCTCCTCTCTGGGG - Intronic
1158543822 18:58379149-58379171 TCTGCAGAGCCTGCTCTGTGGGG - Intronic
1159893884 18:73978718-73978740 CCCACTTCGGCTCCTCTGTGGGG - Intergenic
1160162349 18:76483332-76483354 TCCCCAACACCTCCTCTTTGTGG + Intronic
1160837929 19:1133249-1133271 GCCACGGCTCCTCCTCTGTGAGG + Intronic
1161040228 19:2106736-2106758 TCCACATCGCAGCCTCTGTCAGG - Intronic
1161220335 19:3115504-3115526 CCCACAGCTCCTTCCCTGTGTGG - Intronic
1161290874 19:3492692-3492714 TCCACATCACCTCCTCCCTGAGG - Intronic
1161591486 19:5131179-5131201 GCCACAGCGCCTCCTCTGAGGGG - Exonic
1162786771 19:13040005-13040027 TCCACTGCCCCTCCTCTGTCAGG - Intronic
1163367492 19:16883867-16883889 TTCCCAGCGCTTCCTCTCTGGGG - Intergenic
1163419155 19:17204496-17204518 TCCACACAGCCTCCTCTCTCAGG + Intronic
1164874492 19:31673967-31673989 TCCAGAGGGCCTCCACAGTGGGG + Intergenic
1166267151 19:41691342-41691364 CCCACATCGCCTCCTCCCTGGGG - Intronic
1166991116 19:46693309-46693331 TACTGAGTGCCTCCTCTGTGCGG - Intronic
1167509855 19:49890338-49890360 TCCGCAGCGCCTCCTGCATGTGG + Exonic
1167599344 19:50445260-50445282 ACCCCAGGGCTTCCTCTGTGCGG + Intronic
1168415699 19:56166839-56166861 TCCCCAACCCCTCCTCTCTGGGG + Intergenic
1202678616 1_KI270711v1_random:30323-30345 TCCAGAGCTCTTCCTCTATGTGG + Intergenic
925360813 2:3278820-3278842 TGCACAGGGCAGCCTCTGTGGGG - Intronic
926400965 2:12496210-12496232 TTCACCAGGCCTCCTCTGTGGGG - Intergenic
926800589 2:16656608-16656630 TCAGCAGCTCCTCCTCTCTGAGG - Intronic
927001044 2:18794357-18794379 TCCATGGCCCCTCCACTGTGTGG + Intergenic
927240578 2:20916734-20916756 TCCACGTCACCTTCTCTGTGAGG + Intergenic
927497970 2:23563374-23563396 TGCACAGCCCCTGCTCGGTGAGG - Intronic
927883750 2:26706294-26706316 TCTCCAGCTCCTCCTCTGGGGGG - Intronic
932763708 2:74457414-74457436 TCAGCAGCATCTCCTCTGTGAGG - Exonic
932819697 2:74889146-74889168 CCCACAGAGCCTCCCCTGTAAGG + Intronic
934167720 2:89310037-89310059 TCCACAGCTCCTGATCTATGGGG - Intergenic
934199565 2:89872546-89872568 TCCACAGCTCCTGATCTATGGGG + Intergenic
935383848 2:102480881-102480903 TCCCAAGCGCAGCCTCTGTGTGG - Intronic
942115611 2:172726383-172726405 TCCACACAGCCTGCTGTGTGTGG - Intergenic
946245269 2:218383856-218383878 ACCACGGGGCCTCCTCTCTGTGG - Intronic
946276557 2:218636029-218636051 TCCACACTGCCTCCCATGTGGGG - Intronic
946360366 2:219216037-219216059 TCCGCAGCACCTCCCCTGTGCGG + Exonic
946486948 2:220109885-220109907 TCCACAGCGGTCTCTCTGTGAGG - Intergenic
1174098621 20:48109445-48109467 TGCACAGCCCCTCCATTGTGTGG + Intergenic
1175229049 20:57461897-57461919 TCCACAGGGACCCCTCGGTGGGG + Intergenic
1175844564 20:62051684-62051706 CCCACAGTCCCTCCTCTGAGGGG + Intronic
1179624303 21:42639820-42639842 TCCACAGCACCTCCTCGAGGGGG - Intergenic
1180588403 22:16914371-16914393 TCCACAGCTCCTGATCTATGAGG - Intergenic
1181327099 22:22058231-22058253 TCCATAACCCCTCCTTTGTGAGG + Intergenic
1181329066 22:22075094-22075116 TCCATAACTCCTCCTCTGTGAGG + Intergenic
1181333292 22:22111321-22111343 TCCATAACCCTTCCTCTGTGAGG + Intergenic
1181441958 22:22941388-22941410 TCCCCAGAGCATCCACTGTGAGG + Intergenic
1184118690 22:42436802-42436824 TCCACTGCGTCTTCGCTGTGTGG - Intergenic
1184779140 22:46637616-46637638 TCTACCCAGCCTCCTCTGTGGGG - Intronic
1184782939 22:46658179-46658201 TCCGGAGCTCCTCCTCTATGGGG - Exonic
1185337261 22:50276240-50276262 CCCACAGCGCCCCCTCCCTGCGG - Intronic
1185337274 22:50276280-50276302 TCCACAGCGCCCCCTCCCTGCGG - Intronic
1185337286 22:50276320-50276342 CCCACAGCGCCCCCTCCCTGCGG - Intronic
1185337299 22:50276360-50276382 CCCACAGCGCCCCCTCCCTGCGG - Intronic
1185337312 22:50276400-50276422 CCCACAGCGCCCCCTCCCTGCGG - Intronic
952307322 3:32157698-32157720 TCCACAAGGCCTCTTCTGTCTGG - Intronic
953248867 3:41224633-41224655 ACCACAGCTCCTTCTCTGAGTGG + Exonic
954274913 3:49535865-49535887 TCCTCAGTTCCTCCTCTGTAAGG + Intergenic
954373776 3:50183786-50183808 TCCTCAGAGGGTCCTCTGTGGGG + Intronic
959901441 3:111666151-111666173 TCCTCAACGCCCCCACTGTGAGG + Intergenic
960074685 3:113471368-113471390 TTCACATCATCTCCTCTGTGTGG - Intronic
960971837 3:123145444-123145466 TCCCCTGCGCCGCCTCTGTAAGG - Intronic
966625242 3:182008736-182008758 GCCACAGTGGCTCCTCTGAGTGG - Intergenic
966945105 3:184772243-184772265 TCCAGAACGCCACTTCTGTGTGG + Intergenic
968576808 4:1370439-1370461 TCCCCATCACCTGCTCTGTGTGG + Intronic
968800935 4:2742908-2742930 TACTCTGCACCTCCTCTGTGGGG + Intronic
969558434 4:7929732-7929754 TCCTGAGTGCCGCCTCTGTGTGG - Intronic
969675322 4:8611301-8611323 TCCACAGATCCTCCTTTGTGGGG - Intronic
969696658 4:8738777-8738799 TCCACAGCTGCTCCTCTCTGGGG - Intergenic
973931129 4:55793875-55793897 TCCACACCGCCTCATCCGAGGGG + Intergenic
976717796 4:88141499-88141521 TCCAGGGCTCCTCCTCTGTTAGG - Intronic
979604788 4:122626458-122626480 TCCACAGCACCTTTTCTGTGGGG + Intergenic
984420269 4:179512392-179512414 TCCTCAATGCCTGCTCTGTGTGG + Intergenic
985615139 5:915660-915682 TCCTCAGCTCCTGCTCTGGGAGG - Intronic
985949091 5:3209765-3209787 TCCTTGGCGCCTCCTCCGTGAGG + Intergenic
986168686 5:5297743-5297765 CCCACAGCGCTGCCTTTGTGAGG + Intronic
991024915 5:62019082-62019104 TCCACAGTGTCTACACTGTGCGG - Intergenic
992314214 5:75536271-75536293 TCCACAGGGCTTCCTCAGTCAGG + Intronic
992839979 5:80679072-80679094 TCCACAGAGCCACATCTGTTAGG + Exonic
995243437 5:109911239-109911261 TCCTCAGCTCCTCCTTTCTGGGG + Intergenic
996508087 5:124289780-124289802 CCCACAGCCCCTCCTCTGGCTGG + Intergenic
997424144 5:133791766-133791788 TCCCCTCCTCCTCCTCTGTGAGG + Intergenic
998094941 5:139391670-139391692 GCCACAGCACCTCCTCTGATCGG + Exonic
998160862 5:139812300-139812322 TCCACATCCCCTTCTCAGTGAGG - Intronic
998555523 5:143119389-143119411 TCAACATCAGCTCCTCTGTGTGG - Intronic
998908993 5:146937508-146937530 TCAAAAGCCCCTCCTCTCTGTGG - Intronic
999610543 5:153364554-153364576 CAAACAGCACCTCCTCTGTGAGG - Intergenic
999901219 5:156088838-156088860 TCCAAGCAGCCTCCTCTGTGGGG + Intronic
1001088825 5:168721965-168721987 TCAATAGCACCTCCTTTGTGAGG - Intronic
1001742388 5:174064822-174064844 TCCACAAAGCATTCTCTGTGAGG + Intronic
1001936441 5:175709088-175709110 TCCACAGCCCCCTCTCTCTGGGG - Intergenic
1002087808 5:176786629-176786651 TCCACAACACCTGCTCAGTGGGG - Intergenic
1002787233 6:411612-411634 TTCACAGACACTCCTCTGTGTGG - Intergenic
1003521110 6:6859310-6859332 TTCTCAGCTCCTCCTCTGAGTGG + Intergenic
1004122629 6:12839427-12839449 CCCACAGCGAGTCCTTTGTGGGG + Intronic
1007094082 6:39202705-39202727 CCCAAAGCCCCTCCTCTCTGAGG + Intronic
1009623410 6:66104780-66104802 TCCAAAGCTTCTTCTCTGTGTGG - Intergenic
1010761914 6:79733420-79733442 TCCACAGCACCTCCTCAGCCGGG + Intergenic
1010884084 6:81215445-81215467 TCTCCAGGGCCTCCTCTTTGCGG + Intergenic
1011190811 6:84726327-84726349 TGCACAGCTCACCCTCTGTGTGG - Intronic
1011361496 6:86529835-86529857 ACCACAGCGGCTGCTCTGTATGG + Intergenic
1018656637 6:166043152-166043174 TCCACAGGGCATTTTCTGTGGGG + Intergenic
1019366676 7:636698-636720 TCTACAGCACAGCCTCTGTGAGG - Intronic
1019597567 7:1865247-1865269 TCCACAGTGGCTCCTCCTTGGGG + Intronic
1024544567 7:50506241-50506263 ACCCCAGCATCTCCTCTGTGGGG - Intronic
1027198553 7:76048063-76048085 TGCCCAGCGCCTGCTCTCTGGGG - Exonic
1033823763 7:145164520-145164542 CCCTCAGAGCCTCCTCTGTCTGG + Intergenic
1034535426 7:151723079-151723101 TCCACAGCCCCGGCTCTGAGAGG + Intronic
1035129807 7:156641012-156641034 TCCACAGCTCCTTCTATCTGAGG + Intronic
1035291822 7:157844185-157844207 TGCACACCACCTCCTGTGTGTGG - Intronic
1037776438 8:21838828-21838850 TCCACACCGCCTGCTCAGGGTGG + Intergenic
1037877317 8:22554444-22554466 TCCTCTGCGTGTCCTCTGTGGGG - Exonic
1038143157 8:24868019-24868041 TCCAAAGTCCCTGCTCTGTGGGG - Intergenic
1040530110 8:48260275-48260297 TCCCGAGCGCCCCCTGTGTGTGG + Intergenic
1040726386 8:50386260-50386282 TCCACAGCCCCTCTTCTGATTGG + Intronic
1040881798 8:52213418-52213440 GCCACAGCTTTTCCTCTGTGAGG + Intronic
1041189686 8:55341245-55341267 CCCACTGGGACTCCTCTGTGAGG + Intronic
1041260791 8:56019147-56019169 TTCCCACCCCCTCCTCTGTGGGG - Intergenic
1041635468 8:60137954-60137976 TCCACAGTGCCGCGTCTGAGTGG - Intergenic
1048871983 8:138806746-138806768 CCCACAGCGCCTGCTGTCTGAGG + Intronic
1049007166 8:139862975-139862997 TGCACAGCCCCTCCTCTGCCAGG + Intronic
1049290567 8:141799606-141799628 GCCGCAGGTCCTCCTCTGTGGGG - Intergenic
1049374290 8:142281688-142281710 GCCACAGCCCTTCCTCTATGGGG - Intronic
1057144611 9:92749491-92749513 CCCATGGCCCCTCCTCTGTGAGG + Intronic
1057210507 9:93198613-93198635 TGGACAGCTCCTCCTCTGTCAGG - Intronic
1057526953 9:95811321-95811343 TTCACAGCATCTACTCTGTGTGG - Intergenic
1057719966 9:97524251-97524273 TCCTCAGCTCTTCCTCTGTTAGG - Exonic
1058117176 9:101097731-101097753 TCCACACATCCTCCTCTGGGTGG - Intronic
1059760848 9:117336143-117336165 TCCCCAGCACCTCCTGTCTGAGG - Intronic
1061297034 9:129682380-129682402 TCCTCAGCCCCTCCTCTCTTAGG - Intronic
1061713648 9:132504977-132504999 TCCCCAACACCTCCTCTGTCGGG - Intronic
1061774465 9:132951696-132951718 TGTCCAGCTCCTCCTCTGTGTGG + Intronic
1062005196 9:134235382-134235404 TCCACAGCGCCCCATCTTTTGGG - Intergenic
1062133690 9:134913601-134913623 TGCCCAGCGTCTCCTGTGTGGGG + Exonic
1062250065 9:135589380-135589402 TGGACAGCCCCACCTCTGTGCGG + Intergenic
1188261515 X:28030421-28030443 TCCCCAGCCCATCCTCTGTCTGG - Intergenic
1188642606 X:32524600-32524622 TCCACAAAGCCTTCTTTGTGTGG - Intronic
1189286359 X:39854799-39854821 TCCAGAGCTCCTCCTTTGGGAGG + Intergenic
1193442214 X:81556624-81556646 TCCACAGCTACTCTTCTGTTGGG - Intergenic
1194343969 X:92739469-92739491 TCCACATAGCATCCTCAGTGAGG + Intergenic
1195431486 X:104794496-104794518 TCCACAGTGACTCCTCAGGGAGG + Intronic
1198532436 X:137559753-137559775 TCAACTGCCCCTCCTCAGTGAGG - Intergenic
1199356322 X:146867378-146867400 CTCTCAGCGCCTCCTCTGTCTGG - Intergenic
1200652319 Y:5856125-5856147 TCCACATAGCATCCTCAGTGAGG + Intergenic