ID: 1129770253

View in Genome Browser
Species Human (GRCh38)
Location 15:78198855-78198877
Sequence TAGCAAACCCAAAATGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129770253 Original CRISPR TAGCAAACCCAAAATGCTCA TGG Intronic
901858217 1:12057666-12057688 GAGCACAGCTAAAATGCTCATGG - Intergenic
902522215 1:17026057-17026079 TAGAAAACCAAACATGCTCAGGG + Intronic
903764240 1:25723396-25723418 TAGAAAACCCCAAAGGCTCTGGG - Intronic
904506148 1:30956025-30956047 TACAAAACCCAAAATTGTCATGG + Intronic
909571504 1:77117221-77117243 GAGCAAACCAAAAATCCTGAGGG - Intronic
910269221 1:85375303-85375325 GAGCAAACCCAGAATGCACCTGG + Intronic
910442428 1:87266389-87266411 TAGCAAATCCAAAATCTGCAGGG + Intergenic
910795388 1:91092420-91092442 TGGCAAAAAAAAAATGCTCAAGG + Intergenic
911739212 1:101369050-101369072 TAGCATAACAAAAATGCTTATGG - Intergenic
912731851 1:112114153-112114175 TGGCAAATCCAAAATCTTCAGGG + Intergenic
916586218 1:166152614-166152636 TTCCAAACCCCACATGCTCAGGG + Intronic
917018851 1:170564119-170564141 TAACAAACCCAAAAAACTGATGG + Intergenic
917703433 1:177604540-177604562 AAGCAAACACAAAATGTTCTAGG + Intergenic
918295732 1:183154853-183154875 GTGCAAACCCATATTGCTCAAGG - Intergenic
918627681 1:186676620-186676642 CAGCAAACCGTAGATGCTCAGGG + Exonic
920701024 1:208218110-208218132 TAGAAAAACCAAAATGCAGAAGG - Intronic
921965937 1:221089725-221089747 AAGCAAACCTAAAATGTTTATGG + Intergenic
922299471 1:224284177-224284199 AATCAAACCAAAAAAGCTCAAGG + Intronic
1063558293 10:7101636-7101658 TAGTAAAGCCCAAATGCACAGGG - Intergenic
1063829120 10:9931973-9931995 TAGCAACCCACAAATGCTAAAGG + Intergenic
1063935108 10:11069537-11069559 TAGCAAAAACAGAATGCTCCAGG - Intronic
1065229539 10:23583145-23583167 TACAAAACACAAAATGCCCAAGG - Intergenic
1067229078 10:44394472-44394494 TTGAAGACCCGAAATGCTCATGG + Intergenic
1067338132 10:45380402-45380424 CAGCCACCCCAAACTGCTCACGG + Intronic
1067345454 10:45435014-45435036 TAAGAAACACAAATTGCTCAGGG + Intronic
1067510560 10:46891550-46891572 CAGCAAACCCAAAGTGTTCATGG + Intergenic
1067651693 10:48160312-48160334 CAGCAAATCCAAAGTGTTCATGG - Intronic
1068990772 10:63148052-63148074 TATGTAACCCAAAATGGTCATGG + Intronic
1070851281 10:79563477-79563499 TGGAAGACTCAAAATGCTCAGGG - Intergenic
1071749259 10:88456232-88456254 TAGCAAAACTAAAATTCTTATGG + Intronic
1071881660 10:89905424-89905446 TAGCAAATCCAAAATTCTTAGGG - Intergenic
1072831966 10:98668022-98668044 TAGAAAACCCAAAAGGCTCCTGG + Intronic
1074315012 10:112353187-112353209 TAGAAAACCCTAAAGTCTCAGGG + Intergenic
1074863866 10:117533823-117533845 CACCAAACGCAAAACGCTCAGGG - Intergenic
1078897447 11:15609498-15609520 TGGCAAGTCCAAAATGTTCAGGG + Intergenic
1086894183 11:92293175-92293197 TAGGAAACCAAAAAGGCTCAGGG - Intergenic
1086914569 11:92514261-92514283 GAGCAGACCCAAAATTCTCTGGG - Intronic
1087180614 11:95138352-95138374 CAGCAAACCCAAAAGGCTACAGG - Intergenic
1088909504 11:114180207-114180229 TGGAGAACCCAAAATGGTCAGGG + Intronic
1091169313 11:133506379-133506401 AAGCACCTCCAAAATGCTCAGGG + Intronic
1093253213 12:16833803-16833825 GAGCAAAGCAAAAATGCTGATGG - Intergenic
1096745200 12:53722256-53722278 TCCCAAACCCAAAATGCACCTGG - Intronic
1098204294 12:68091486-68091508 TGGCAAAACAAAAAGGCTCATGG - Intergenic
1098305369 12:69097304-69097326 TGGCAAATCCAAAATCTTCAGGG + Intergenic
1098305966 12:69102936-69102958 TAATAAAACCACAATGCTCATGG - Intergenic
1100339183 12:93661939-93661961 TAGCAGACTGAAAATTCTCAAGG - Intergenic
1105292335 13:19060975-19060997 GAGCCTACCCAAAAAGCTCAGGG - Intergenic
1106188272 13:27427478-27427500 GAGCTAACATAAAATGCTCATGG + Intronic
1106563357 13:30865121-30865143 CAGCAAACACACAATGCTCACGG + Intergenic
1107691362 13:42956786-42956808 AAGGAAACCCAAGAAGCTCATGG + Intronic
1110053800 13:70939356-70939378 TAGCAATAACAAAATGCTGATGG - Intergenic
1111128134 13:83938808-83938830 TAGCAAACCAAAAACACTTAGGG - Intergenic
1113907758 13:113827928-113827950 TACAAAACCCAAAATGTTCTTGG + Intronic
1116792563 14:49355149-49355171 TCTCAAACCCAAAAACCTCAGGG + Intergenic
1120089339 14:80312776-80312798 TCTGAAACCCAAAATGCTCCAGG - Intronic
1120724441 14:87922159-87922181 TAGCAAATCCAAAATCTACAGGG + Intronic
1123959863 15:25386056-25386078 TAGCAAAGCCAAAATGATGTGGG + Intronic
1124985177 15:34602068-34602090 GAGAAAGCCCAGAATGCTCATGG - Intergenic
1128220015 15:65962493-65962515 TACCCAGCCCAAAATGTTCATGG + Intronic
1129770253 15:78198855-78198877 TAGCAAACCCAAAATGCTCATGG + Intronic
1129882630 15:79017133-79017155 GAGCAGACCCAGAATGCCCATGG - Intronic
1130673441 15:85932447-85932469 TAGCAACTCCAAAATGGGCAGGG + Intergenic
1131665042 15:94561335-94561357 AAGCAAACCTAAAAAGCTAATGG - Intergenic
1133893793 16:9906309-9906331 GAGCAAACCCAAACCACTCATGG + Intronic
1134828812 16:17306782-17306804 TAGGAAACTCAAAATTCCCAAGG - Intronic
1138617852 16:58185493-58185515 AAGCAAAACAAAAATGCTCCTGG + Intronic
1138931363 16:61660760-61660782 TAACATATTCAAAATGCTCAAGG + Intronic
1140253508 16:73315725-73315747 TAGCAAACGCAAAGTGCCTAAGG + Intergenic
1141394401 16:83691833-83691855 TAGCTACACCAAATTGCTCAAGG + Intronic
1141630176 16:85283372-85283394 AAGCAGAGCCAAGATGCTCAGGG - Intergenic
1142168401 16:88606127-88606149 TAGGGAACCCAAAATGTTAATGG - Intronic
1143102329 17:4511370-4511392 TAGCCACCCCAAACTACTCATGG - Intronic
1144081880 17:11770424-11770446 TAGCCAACTCAAAATGCTGATGG + Intronic
1147242139 17:39097363-39097385 TAGTAAACCCCAAATGATCATGG - Intronic
1148334073 17:46829960-46829982 TAGTTTACCCAAAAAGCTCAGGG + Intronic
1149418641 17:56487004-56487026 TAGCAAAGACAAAATGATAAAGG + Intronic
1155074458 18:22342461-22342483 TAAGAAGCCCAAAATGCTGAGGG - Intergenic
1155945974 18:31851965-31851987 AAACAAACCAAAAATGCTTATGG - Intronic
1156055437 18:32997503-32997525 TGGCAAATCCAAAATCTTCAGGG - Intronic
1158910448 18:62056157-62056179 AAGCAAAACCAAAATGCCAAAGG + Intronic
1164544884 19:29152102-29152124 TAGGAAACCCACAATTCCCAGGG - Intergenic
1165698879 19:37922056-37922078 CAGCAAACCCCAAATGCTGATGG + Intronic
1165738989 19:38194536-38194558 TAACAAACTCAAAAAGGTCAGGG - Intronic
1166572517 19:43806685-43806707 AAACAAACCCAACAAGCTCAGGG + Intronic
925045775 2:772074-772096 TAGCAGACCCACAATTTTCATGG - Intergenic
925238547 2:2300656-2300678 TAGACAACTCAAAATGCGCATGG - Intronic
927061648 2:19428457-19428479 TACCAAACACATAAAGCTCAAGG - Intergenic
927141318 2:20132909-20132931 AGGCAAACCCAAAATGCTGGAGG + Intergenic
927445071 2:23152919-23152941 TAACATACTCAAAATGCTGAAGG + Intergenic
928274721 2:29890140-29890162 CAGCAAAACCAAAGTGCTAAGGG - Intronic
929915708 2:46133791-46133813 GAGGAAACCAATAATGCTCAAGG + Intronic
930285186 2:49418978-49419000 TGGTAAATCCAAAATGCTCTTGG + Intergenic
930465440 2:51742513-51742535 TAGCAAAATCAAATTGCTAATGG + Intergenic
938732935 2:134160493-134160515 TGGCTCACCCAAACTGCTCATGG + Intronic
938972292 2:136443511-136443533 GAGCAGGCCCAAAGTGCTCATGG + Intergenic
940497517 2:154452133-154452155 GAGCAAACCTGAAATGCTCCAGG - Exonic
940793563 2:158053357-158053379 TAGTACACCCCAAATTCTCAAGG + Intronic
941005431 2:160242376-160242398 TAGCAAATCCAAAATCTGCAGGG + Intronic
942388226 2:175464162-175464184 GAGCAAACACGAAAGGCTCAAGG + Intergenic
942784152 2:179681351-179681373 TAGCATAACCAAACTGTTCAGGG + Intronic
944695168 2:202194165-202194187 GAGAAAACCCAAGATGGTCAGGG - Intronic
944973879 2:205025198-205025220 TAGCAAAGGCAAACTGCTCACGG + Intronic
947153108 2:227134365-227134387 AAGCAAACCCAACAAGCTCAGGG + Intronic
1169512696 20:6281730-6281752 TAGAAAACACAATATTCTCAAGG - Intergenic
1170421527 20:16198242-16198264 TATCAATCCCAAAAAGTTCAAGG - Intergenic
1172759618 20:37313039-37313061 AAGCTATCCCAAAGTGCTCATGG + Intronic
1175707203 20:61188663-61188685 TAGCAAAGACAAAATGCGTAAGG - Intergenic
1178512334 21:33215963-33215985 TCTCAAATCCAAAATGCTCCAGG - Intergenic
1178752894 21:35321282-35321304 TAGCAAACGTAGAATACTCATGG - Intronic
1179280111 21:39926682-39926704 TAGCAAACCCAGAATGCAAATGG - Intronic
1179778695 21:43685558-43685580 TACAAAAGCCAAAAAGCTCAAGG - Intronic
1182150715 22:28025345-28025367 AAGCAAACGTAAAAAGCTCAAGG + Intronic
951361807 3:21734263-21734285 TAGGAAACCCAGAACACTCAGGG + Intronic
952090534 3:29879821-29879843 TAACAAAGCCAAAATGATGATGG - Intronic
954958172 3:54540423-54540445 TATCAAATTCAAAATGCCCATGG - Intronic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
955349971 3:58186105-58186127 TTTCAAAACTAAAATGCTCATGG + Intergenic
956088861 3:65642438-65642460 CAGCAAACCAAAAATACTTAAGG + Intronic
956293329 3:67684963-67684985 CATGAAACCCAAAAGGCTCAGGG - Intergenic
957887732 3:86311816-86311838 TAACAAACCAAAAATGATTAAGG - Intergenic
959227914 3:103609583-103609605 TAGCAAACTCAAAATTTACAGGG + Intergenic
959974982 3:112448535-112448557 TAGCAAATCCAAAATCTGCAGGG + Intergenic
961135861 3:124510499-124510521 TAGCACACAAAAAATGCTGAGGG + Intronic
962255017 3:133864724-133864746 TAACAAAACCAAAAAGCACAGGG + Intronic
964513949 3:157485990-157486012 TGGCAAACCCAAAATTATAATGG + Intronic
965319784 3:167239077-167239099 TAGCAAGTCCAAAATCCACAGGG + Intergenic
965513524 3:169595239-169595261 TTCTAAACCCAAAATGCACAAGG + Intronic
967688656 3:192447236-192447258 GAGAAAACCCAATTTGCTCAAGG + Intronic
967870770 3:194227104-194227126 TAACAAACCCAAAATTAACAAGG + Intergenic
971346626 4:25817465-25817487 AAGCAAACCCAAATTGCACTGGG + Intronic
971662908 4:29443100-29443122 TGGCAAATCCAAAATGTGCATGG - Intergenic
972739212 4:41874615-41874637 AACAAAACCCAAAAGGCTCAGGG + Intergenic
974022057 4:56700456-56700478 TAGCAAATCCAAAATCTGCAGGG - Intergenic
975443910 4:74440850-74440872 TTTCAAACCCATAATGTTCAAGG - Intergenic
981932520 4:150206334-150206356 TAGCACACAGTAAATGCTCAAGG + Intronic
983833427 4:172359944-172359966 TAGCAAAAACAATATGTTCAGGG - Intronic
984120770 4:175739671-175739693 TAGCAAACCTCAAATTCTTAAGG + Intronic
986803653 5:11287248-11287270 CAGATAACCCAAAATGCGCATGG + Intronic
986966240 5:13275333-13275355 ATGCAAACCCAAAATAGTCATGG + Intergenic
987464027 5:18251288-18251310 AAGCAATCCCAAAGTCCTCAGGG + Intergenic
989459358 5:41679324-41679346 TAGGAAACCCTAAAGGCTCCTGG + Intergenic
989663688 5:43826074-43826096 AAGCATACCCAAAATGATAAAGG - Intergenic
991560786 5:67949761-67949783 TATCAAACCCAAAATGTCAAAGG - Intergenic
992076837 5:73199639-73199661 AAGCAACCCCCAAATGCTGAAGG + Intergenic
993962417 5:94316000-94316022 AAACAAACCCAAAATACACATGG - Intronic
996263463 5:121503792-121503814 TAGCAAAACCACAATACTCAAGG + Intergenic
996808672 5:127488747-127488769 TAGCATGGCCAAAATGCTGAAGG + Intergenic
1000508525 5:162152262-162152284 TAGTAGAGCCAAAAGGCTCAGGG - Intronic
1004321515 6:14635028-14635050 TAGCAAGTCCAAAACGTTCAGGG - Intergenic
1004477896 6:15990953-15990975 CAGCAAACCCTAAAATCTCAGGG + Intergenic
1009552829 6:65121050-65121072 TAGTAGAGTCAAAATGCTCAGGG - Intronic
1014059688 6:117056817-117056839 AAGCAATCCCAAAATTCTTATGG - Intergenic
1014992425 6:128097976-128097998 TAGCAAAGACAAAATTCTAAGGG + Intronic
1015559765 6:134501985-134502007 AAGCCAACCAAAAATGTTCATGG - Intergenic
1018698283 6:166407457-166407479 TAGGAAACCCTAATTGTTCATGG - Intergenic
1021120734 7:16792579-16792601 AAACACACACAAAATGCTCAAGG - Exonic
1022834899 7:34104041-34104063 TAGCAATCCCCAAATGCACTTGG + Intronic
1022836618 7:34122663-34122685 ATGCAAAACCAAAATTCTCAAGG - Intronic
1023960150 7:44919758-44919780 TGGCAAAGCCAAAATTCTCATGG + Intergenic
1026664313 7:72329432-72329454 TATCAAACCCAAACTCCACAGGG + Intronic
1028812452 7:95103138-95103160 TAGCAAATCCAAAATCTGCAGGG - Intronic
1030857897 7:114584301-114584323 AAGCAAAGCCAAAGTGTTCAAGG - Intronic
1035739058 8:1912519-1912541 CAGCAAACCCACAATCCACACGG - Intronic
1035939524 8:3881824-3881846 AAGCAAATCCACACTGCTCAGGG + Intronic
1036685650 8:10908232-10908254 AAGGAAATCGAAAATGCTCAAGG + Intronic
1038315188 8:26478384-26478406 TAGCAAACCTAAAATTTGCATGG - Intronic
1039653149 8:39366107-39366129 TAGCAAAGGAAAAAGGCTCATGG + Intergenic
1040944987 8:52874622-52874644 TGGCAATCCAAAAATGCCCATGG - Intergenic
1043949870 8:86296943-86296965 TAGCAAATCCAAAATTTGCAGGG - Intronic
1044450933 8:92335436-92335458 TAGAGAACCCAAACTGATCAGGG - Intergenic
1044624708 8:94225906-94225928 TAGCAAATCTAAAATCCGCAGGG + Intergenic
1044964231 8:97559520-97559542 TAGCAAACACAAAGTTCTTAAGG - Intergenic
1046926636 8:119797655-119797677 TACCAACCTAAAAATGCTCATGG + Exonic
1048056007 8:130866157-130866179 TAGCAAAACCAAAAACCTCATGG - Intronic
1048378168 8:133840807-133840829 GAGCAAACCCAAGATTCTCCAGG + Intergenic
1048615813 8:136074503-136074525 TTGCAAACCCCAAATCCTCTTGG - Intergenic
1048951479 8:139500454-139500476 TACCAAAACCAAACTGCTTATGG + Intergenic
1050832095 9:10027445-10027467 TAGCAGACCCAAAATACTGTTGG - Intronic
1051037013 9:12760079-12760101 GAGCAAACAAATAATGCTCAGGG + Intergenic
1051729735 9:20128030-20128052 AAGCAAAACCAAAAGGCTTAAGG - Intergenic
1056622748 9:88227711-88227733 TGGCAAACCCAAAATCCACAGGG - Intergenic
1057157846 9:92859760-92859782 TAGAAAAGCCATAATACTCATGG + Intronic
1057182901 9:93039467-93039489 TTCCAGACCCAAAGTGCTCAGGG - Intergenic
1061816303 9:133199419-133199441 GAGCAAAACCAAAATGCCAAGGG + Intergenic
1186200254 X:7148795-7148817 GAGCAAAGCCAAGCTGCTCAAGG + Intergenic
1186776812 X:12872994-12873016 GAGAAAGCCCAACATGCTCAGGG + Intronic
1187492950 X:19769549-19769571 TAACATACTCAAAATGCACATGG + Intronic
1187549039 X:20282801-20282823 TAGCAAATCACAAATGCTTAAGG - Intergenic
1187618895 X:21028718-21028740 TAGCAAACCCAAATTTCACAAGG - Intergenic
1189676412 X:43465064-43465086 TAGAAAACCGACAATGCACAGGG - Intergenic
1190029772 X:46960644-46960666 TAGCAAAGGGAAAAGGCTCATGG - Intronic
1192316355 X:70054770-70054792 TAGCAAACTAAGAATGATCAGGG + Intergenic
1194945871 X:100066311-100066333 TTGATAAGCCAAAATGCTCAGGG + Intergenic
1195005967 X:100686275-100686297 GAGGAAACTCAAAGTGCTCAGGG - Intronic
1196500256 X:116372636-116372658 AAACAAACCCAAAATGATCAAGG - Intergenic
1199009479 X:142741885-142741907 TAGCAAATCAAAACTGCTAATGG + Intergenic
1201589715 Y:15601593-15601615 CAGAAAACCAAGAATGCTCAGGG - Intergenic