ID: 1129771666

View in Genome Browser
Species Human (GRCh38)
Location 15:78206836-78206858
Sequence ATGCTTTTCTGGGGCTCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 145}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129771655_1129771666 20 Left 1129771655 15:78206793-78206815 CCCGCAGGGCTGGGGATTATGTG 0: 1
1: 0
2: 0
3: 18
4: 221
Right 1129771666 15:78206836-78206858 ATGCTTTTCTGGGGCTCCAAGGG 0: 1
1: 0
2: 0
3: 15
4: 145
1129771656_1129771666 19 Left 1129771656 15:78206794-78206816 CCGCAGGGCTGGGGATTATGTGT 0: 1
1: 0
2: 1
3: 23
4: 222
Right 1129771666 15:78206836-78206858 ATGCTTTTCTGGGGCTCCAAGGG 0: 1
1: 0
2: 0
3: 15
4: 145
1129771659_1129771666 -8 Left 1129771659 15:78206821-78206843 CCCTCGGGATGCCAGATGCTTTT 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1129771666 15:78206836-78206858 ATGCTTTTCTGGGGCTCCAAGGG 0: 1
1: 0
2: 0
3: 15
4: 145
1129771660_1129771666 -9 Left 1129771660 15:78206822-78206844 CCTCGGGATGCCAGATGCTTTTC 0: 1
1: 0
2: 1
3: 5
4: 105
Right 1129771666 15:78206836-78206858 ATGCTTTTCTGGGGCTCCAAGGG 0: 1
1: 0
2: 0
3: 15
4: 145
1129771652_1129771666 29 Left 1129771652 15:78206784-78206806 CCATTGAGGCCCGCAGGGCTGGG 0: 1
1: 0
2: 2
3: 24
4: 235
Right 1129771666 15:78206836-78206858 ATGCTTTTCTGGGGCTCCAAGGG 0: 1
1: 0
2: 0
3: 15
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129771666 Original CRISPR ATGCTTTTCTGGGGCTCCAA GGG Intronic
900902312 1:5525377-5525399 ACCCTTTTCTGGGTCTCCCATGG - Intergenic
901336335 1:8452229-8452251 ATGGTGTTCTGGGGCTCACAGGG - Intronic
901512206 1:9723046-9723068 ATGAGTTTCTGGGGCTCAAGTGG + Intronic
907763225 1:57382553-57382575 ATTCCTTTCTGGAGCTTCAAAGG + Intronic
909736402 1:78967959-78967981 TGGCTTTTCTGAGGCTCCAGAGG + Intronic
910323206 1:85973557-85973579 CTTCTGTTCTGGGGCTCAAAAGG + Intronic
910934627 1:92477378-92477400 ATACTTTTCTGGGTTTTCAATGG + Intronic
913498923 1:119452741-119452763 ATGCTTTTCTGGACCTACCAGGG - Intergenic
915399813 1:155613879-155613901 ATGCTTTTCTTGGGAGCCATAGG - Intronic
915416971 1:155749744-155749766 ATGCTTTTCTTGGGAGCCATAGG - Exonic
918374464 1:183895292-183895314 ATGCTGTTCTTGGGCTTCAGAGG - Intronic
918835692 1:189462100-189462122 AGGCTTTTCTTGGACTCCCATGG - Intergenic
921900240 1:220442161-220442183 ATTCTTTTCTGGGAGTCCAGTGG + Intergenic
923751495 1:236750754-236750776 ATGCTTTTGTAGGACTGCAAAGG + Intronic
1065943559 10:30586998-30587020 ATGCTGTTCTGGGACTCAAGAGG + Intergenic
1067133160 10:43584555-43584577 ATGTTTTTCTGGGGTCCCAGGGG + Intergenic
1071452729 10:85813122-85813144 CTCTTCTTCTGGGGCTCCAATGG - Intronic
1072873299 10:99144314-99144336 ATGTTATGCTGGAGCTCCAAAGG - Exonic
1073309837 10:102532507-102532529 ATCCTCATCTGGGGCTCCAGTGG + Intronic
1073978057 10:109122708-109122730 ATGCTATTCTAGGGCTGCCATGG - Intergenic
1074974758 10:118571078-118571100 TAGCTTTTCTGGTCCTCCAAGGG + Intergenic
1076234974 10:128856388-128856410 GTGTTTTTCTGGAGCTCAAAGGG + Intergenic
1077493209 11:2871645-2871667 TTTGTTTTCTGGGGCTCCAAGGG + Intergenic
1086948720 11:92869435-92869457 TTGCTTTCCTGGGGAGCCAAGGG + Intronic
1088224979 11:107610084-107610106 ATGCTTTTCTAGGACACCCATGG - Intronic
1089388533 11:118084101-118084123 ATGCATATCTGGGGCTCCTTAGG + Intronic
1089560624 11:119341424-119341446 ATCCTTCTCTGGGGCTCCCAGGG - Exonic
1090113681 11:123943321-123943343 CTGCCTTTCTGTGGCCCCAATGG - Exonic
1091902600 12:4156615-4156637 ATGCTGCCCTGGGGCTCAAAAGG - Intergenic
1093731222 12:22567943-22567965 ATTCTTTTCTGGTGCTCAAAAGG + Intergenic
1095239877 12:39845600-39845622 ATGTCATTCTGGGGCTCCAGGGG - Intronic
1096287558 12:50313559-50313581 ATCCTTCTCTGGGACTCAAAGGG - Intergenic
1097191994 12:57223912-57223934 GTTCTTTTCCTGGGCTCCAAGGG - Intronic
1103259715 12:119576139-119576161 AAGCTCTTCTTGGGCTCCTAGGG - Intergenic
1104457784 12:128929560-128929582 ATGCTTTTTTGGGGTCCCTAGGG - Intronic
1104876336 12:132037535-132037557 ATGCCTTCGTGGGGCACCAAAGG - Intronic
1106285352 13:28313783-28313805 ATGCCTTTAGGGGGCGCCAATGG + Intronic
1108684106 13:52804019-52804041 ATGCTTTAGTGGGACTGCAAAGG - Intergenic
1110218681 13:73050650-73050672 GTGCTTTACTGGGGATACAAAGG + Intergenic
1117668901 14:58085545-58085567 CTCCTTTTCTGGCTCTCCAAAGG + Intronic
1118127174 14:62919408-62919430 ATGCATTTCTGGGACTCACAGGG + Intronic
1122077359 14:99245136-99245158 CTGCTTTTCTGGGCCTTTAAGGG + Intronic
1125403481 15:39329029-39329051 ATGCTTTGCTGGGGATTCATGGG - Intergenic
1128339348 15:66809512-66809534 ATGGTTTTCTGGGACCCCGAGGG - Intergenic
1128506440 15:68276442-68276464 ATGCATTTATGTGGCTCCAAGGG - Intergenic
1129771666 15:78206836-78206858 ATGCTTTTCTGGGGCTCCAAGGG + Intronic
1130830010 15:87589862-87589884 CTGCTTTCCTGAGGCTCCAGAGG + Intergenic
1134317024 16:13127971-13127993 ATGCTTTTCTCTGGCTCAATAGG + Intronic
1136738750 16:32491695-32491717 ATGCTTTTCTGGATCTGCAAAGG + Intergenic
1137760309 16:50935064-50935086 CTTCTTTTCTTGGGCACCAAGGG + Intergenic
1139046096 16:63061751-63061773 ATTCTTGTCTGGTGCCCCAAAGG + Intergenic
1139596107 16:67959300-67959322 AGGCTTTGCTGGGGCTCCAGTGG - Intronic
1203014463 16_KI270728v1_random:340096-340118 ATGCTTTTCTGGATCTGCAAAGG - Intergenic
1203032798 16_KI270728v1_random:613255-613277 ATGCTTTTCTGGATCTGCAAAGG - Intergenic
1143111539 17:4555589-4555611 ATGCCCCCCTGGGGCTCCAAAGG - Intronic
1143287134 17:5798584-5798606 ATGGTTTTCTGGCCCTCCTAGGG + Intronic
1150502976 17:65668856-65668878 ATGCTTTTCTTTGGTTCCATTGG + Intronic
1151350771 17:73530819-73530841 ATGCTCTACTGGGGCCACAAGGG - Intronic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1153180720 18:2429705-2429727 ATGCATATATTGGGCTCCAAAGG - Intergenic
1153433720 18:5046750-5046772 TTTCTTTTCTGGGGCTTCAATGG - Intergenic
1155424411 18:25691215-25691237 TTGCTTTCCAGGGGCTCCAGTGG - Intergenic
1155734463 18:29203266-29203288 TTGATTTTGTGGGGCACCAATGG + Intergenic
1158546381 18:58401051-58401073 AGGGTTTTCTTAGGCTCCAAGGG - Intronic
1161493325 19:4574773-4574795 ATGCATCTCTGGGGCTCCTGGGG + Intergenic
1164032465 19:21419839-21419861 CTGCTATTCTGGGTCTCCTAGGG + Intronic
1164747047 19:30624120-30624142 ATGCTATTATAGGGCTCCCAAGG - Intronic
1167273077 19:48517362-48517384 ATGCTTTCCTTGGCCACCAATGG + Intergenic
925050728 2:813230-813252 ATTCTCTTCTGGGGCTCACATGG + Intergenic
925910122 2:8568431-8568453 ATGCATTTCTGTAGCTCCACAGG + Intergenic
927378605 2:22450620-22450642 ATTCCTTTCTGTGGCTCCACAGG + Intergenic
929749473 2:44694871-44694893 ATGCTTTTATGGAGGCCCAAAGG + Intronic
930870779 2:56168689-56168711 ATGCTTGTCTGGGGAGCCACAGG + Intergenic
931124167 2:59255190-59255212 ATGCTTATCTGCTGCTCCATTGG + Intergenic
932161769 2:69466541-69466563 ATGCTTTTCTAGATCTCCAGAGG - Intronic
933130159 2:78662396-78662418 TGGCTGTTTTGGGGCTCCAATGG + Intergenic
933173707 2:79154487-79154509 CTGCTGTGCTGGGGGTCCAAAGG + Intergenic
934916147 2:98302602-98302624 ATGGTGTTCTGAGGATCCAAGGG - Intronic
937136536 2:119558382-119558404 AGGCTTCTCTTGGCCTCCAAGGG - Intronic
937666969 2:124498989-124499011 ATGCTTTTCTGGGTGGCCAGAGG - Intronic
937707888 2:124942122-124942144 ATGCATTTGTGGGGCAGCAAGGG - Intergenic
940202403 2:151166205-151166227 ATGATTTTCTGAAGATCCAAAGG + Intergenic
941599436 2:167523054-167523076 ATGCTTTTCTGGGGAGTCATGGG - Intergenic
942191999 2:173479394-173479416 TTGCTCTTCTGGTGGTCCAAGGG + Intergenic
944580946 2:201132368-201132390 ACACTTTTCTGGGGCTCCTAAGG - Intronic
946125347 2:217557825-217557847 CTGCTTTGATGGAGCTCCAAAGG - Intronic
1173259111 20:41417539-41417561 ATCCTGCTCTGGGGCTCCCAAGG + Intronic
1174567412 20:51475467-51475489 ATGTTGTTTTTGGGCTCCAAGGG + Exonic
1176879854 21:14179033-14179055 ATTCTTGTCTGGAACTCCAAAGG - Intronic
1179566718 21:42253531-42253553 CTGCTTGCCTGGGGGTCCAATGG - Intronic
1181324234 22:22032529-22032551 ATGCTGTTCTGTGGCTCCCTGGG - Intergenic
1181534103 22:23532965-23532987 ATGGCTTTCTGGGACTCCCAGGG - Intergenic
1183828776 22:40407180-40407202 ATGGTTCTCTGGGCCTCCTAGGG + Exonic
949674575 3:6438753-6438775 ATGCTTTAATGGGGATACAAAGG - Intergenic
951617184 3:24560364-24560386 CTGCTTTTCTAGGATTCCAAAGG - Intergenic
952056140 3:29449119-29449141 ATGCTTGTCAGTGGCTACAAAGG + Intronic
959728511 3:109573470-109573492 TTGCTTTTCTGTGCCACCAATGG + Intergenic
960541758 3:118869583-118869605 AAGTTTTTCTGGGGTACCAAAGG - Intergenic
963922930 3:150923483-150923505 ATGCTTCTCTAGGGCTCCCAAGG - Intronic
968270320 3:197398593-197398615 TTGCTTTCTTGGGGCTCAAATGG - Intergenic
969524284 4:7696232-7696254 AAGCTGTTCTGGGGCCCCAGAGG - Intronic
969920959 4:10539271-10539293 ATGCTTGTGTGGGGCTGTAATGG + Intronic
970224593 4:13844467-13844489 ATGCTCTCCTGGGGCTGAAAAGG + Intergenic
971015919 4:22488568-22488590 ATGCTTTTCTCTGCCTCCCATGG - Intronic
974060788 4:57033216-57033238 ATGCTTTTCTGGGCCACCCCGGG + Exonic
974858904 4:67496000-67496022 ATGATGTTCTGGGGCTTAAAAGG + Intronic
976937848 4:90661386-90661408 TTGCTTTTCTGAAACTCCAAGGG + Intronic
978233392 4:106428139-106428161 ATGTCTTTCTTGGTCTCCAAAGG - Intergenic
978446987 4:108789240-108789262 AGTCTTCTCTGGGGCTCCAGTGG - Intergenic
981248615 4:142571155-142571177 AAGCTTTTCTGGGGGTGCCAAGG - Intronic
981836277 4:149057957-149057979 CTGCTTAGCTGGGGCTACAAGGG - Intergenic
984946365 4:184971735-184971757 ATGCTTGCCTGGGGCTCCCATGG - Intergenic
986832241 5:11592720-11592742 ATGCTTTTCTGGGGGGGTAAGGG + Intronic
988705537 5:33722958-33722980 CTGCTTTTCTTGGGCTTCCAGGG - Intronic
991478109 5:67045176-67045198 ATGTTCTTCTGGGTATCCAAAGG + Intronic
991526111 5:67559934-67559956 CTGCTCTTATGGGGTTCCAAAGG + Intergenic
992118554 5:73565980-73566002 ATGCTCTTCTGGGGCTTCCCAGG + Intronic
993169168 5:84394871-84394893 ATCCTTTTTTGGGTCTCAAATGG + Intergenic
993596428 5:89862392-89862414 AAACTTTTCTAGGGCACCAATGG + Intergenic
994643061 5:102434316-102434338 ATGCTTGTCTTTGGCTCCAGAGG - Intronic
995369899 5:111407422-111407444 ATGCCTTTCTGGACCTCAAAAGG - Intronic
996338207 5:122407978-122408000 GTCCTTTTCTGTGGTTCCAAAGG - Intronic
997957001 5:138286545-138286567 ATTCTCTTCTGGGTGTCCAAAGG + Exonic
998166546 5:139847563-139847585 ATGCTCATCTGGGGCTCCGGGGG - Intronic
1004755044 6:18601789-18601811 GTTCTTTGCTGGGGCTTCAAAGG + Intergenic
1007063644 6:38967057-38967079 ATGCTTTTCTGCATCTGCAATGG - Intronic
1010543459 6:77121582-77121604 AGACTTTTCAGAGGCTCCAAAGG + Intergenic
1011412472 6:87080191-87080213 ATGCTTTTCTGGAGTTCGGAAGG + Intergenic
1017328176 6:153164748-153164770 ATGCTTCTCTTTGGTTCCAAAGG - Intergenic
1018659616 6:166073923-166073945 ATGCCTTTCTGGGACCCCCACGG + Intergenic
1018841868 6:167523296-167523318 ATGCTTGTCTGGGGCACCTTCGG + Intergenic
1021288455 7:18813329-18813351 ATGCTTCTCTGGGGCTTCTTTGG + Intronic
1025550376 7:62239346-62239368 ATGCTTTTCTGGATCTGCAAAGG + Intergenic
1031784531 7:126012868-126012890 ATGCTTCTCTGAGGCACCACTGG - Intergenic
1033757586 7:144407682-144407704 ATCCTTTTCTGGGCTTTCAAAGG - Intronic
1034207081 7:149326916-149326938 ATGCTCTCCTGGGGCTCAACTGG - Intergenic
1036060159 8:5308229-5308251 ATGAGGTTCTGGGGCACCAACGG - Intergenic
1037681629 8:21102420-21102442 ATGGTTGTCTTGGGATCCAAAGG + Intergenic
1037790010 8:21930466-21930488 AGGCTTTCCTGGATCTCCAAGGG - Intronic
1038182753 8:25244442-25244464 ATGCTTTTGTTGTGCTCCAGAGG - Intronic
1041162602 8:55060530-55060552 ATTCTCTTCTAGGGCTACAAGGG - Intergenic
1044908022 8:97026090-97026112 AAGGTGTTCTGGGGCTCCTAAGG + Intronic
1049162005 8:141103701-141103723 ATGCTTCTCTAGGTCTCCAAAGG - Intergenic
1050169979 9:2805150-2805172 GTGGTTTTCTGAGGCTCAAATGG + Intronic
1053239058 9:36481690-36481712 ATGCTGTTCTGGGGGCTCAAGGG - Intronic
1055569471 9:77601873-77601895 ATGCTTTCCAGGGCCACCAATGG + Intronic
1056065510 9:82929570-82929592 ATTATTTTCTGAGGCTCCACTGG - Intergenic
1058868642 9:109183824-109183846 ATGCTCTTCAGTGGCTCCAATGG + Intronic
1059833979 9:118129330-118129352 ATGGCTCTCAGGGGCTCCAAAGG + Intergenic
1060249954 9:121978356-121978378 GTTCTTTTCTGGGGTCCCAAGGG + Intronic
1186326411 X:8482149-8482171 ATACTTTTCTGGGGTCCCAGAGG + Intergenic
1187789159 X:22929758-22929780 ATGCTCTACAGGGGCTCCAGAGG - Intergenic
1188125235 X:26359382-26359404 ATGCTTTTCTTGACCCCCAAAGG - Intergenic
1188178912 X:27028914-27028936 ATCATTTTCTGGTGCTTCAAAGG + Intergenic
1189429277 X:40932699-40932721 CTGTTTTTCAAGGGCTCCAAAGG - Intergenic
1192256444 X:69464397-69464419 TTCTCTTTCTGGGGCTCCAATGG + Intergenic
1194217964 X:91154675-91154697 ATGTTTGTCTGGGGGTCCAGGGG - Intergenic
1196026419 X:111045864-111045886 ATGTTGGTCTGGGGCTCCATTGG + Intronic
1197884788 X:131207198-131207220 ATGCTTTTCTGTGTCTCTACGGG + Intergenic
1198073106 X:133169048-133169070 ATGCTTTTCTCCAGGTCCAATGG - Intergenic
1200554469 Y:4618460-4618482 ATGTTTGTCTGGGGGTCCAGGGG - Intergenic