ID: 1129772907

View in Genome Browser
Species Human (GRCh38)
Location 15:78214063-78214085
Sequence CTGTGGGAATGGGGGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 524
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 489}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129772907_1129772917 -4 Left 1129772907 15:78214063-78214085 CCCAGCTCCCCCCATTCCCACAG 0: 1
1: 0
2: 0
3: 34
4: 489
Right 1129772917 15:78214082-78214104 ACAGGAGAGCCCCTGTTCCATGG 0: 1
1: 0
2: 1
3: 23
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129772907 Original CRISPR CTGTGGGAATGGGGGGAGCT GGG (reversed) Intronic
900164851 1:1240576-1240598 CAGGGTGAATGGGGGGGGCTGGG - Intergenic
900244242 1:1630232-1630254 GTGGGGGAATGCGGGGAGCAGGG - Intronic
900382364 1:2391299-2391321 CTGTGGGAGTGGGGGACGCGGGG + Intronic
900690386 1:3977246-3977268 GTGGGGGAACGGGGGAAGCTAGG + Intergenic
900964541 1:5948629-5948651 CTCTGGGAAAGGGGGGCTCTGGG - Intronic
901679740 1:10906146-10906168 CTGTGGGGGTGGGGAGAGCCTGG + Intergenic
902046695 1:13530015-13530037 CTGTGGGAAGAAGGGCAGCTTGG + Intergenic
902700261 1:18167572-18167594 CGGTGGGAAAGGAGGGAACTTGG - Intronic
903076342 1:20769951-20769973 CTCTAGGAATGGGGTGAACTAGG + Intronic
903136585 1:21313358-21313380 CTGGGGGGATGGAGGGAGCCCGG + Intronic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
903619150 1:24685479-24685501 GTGTGGGAGTGTGGGGACCTTGG - Intergenic
904581550 1:31547733-31547755 CGGTGGGGATGGGTGGAGCATGG + Intergenic
904629430 1:31829985-31830007 CTGTGGGAAGGAGGGAAGCAGGG + Intergenic
904835217 1:33331316-33331338 CTGGGGAAATGGAGGGGGCTGGG + Intronic
905020130 1:34804799-34804821 CTGTGGGGTTGGGTGGAGCAAGG - Intronic
905239861 1:36574543-36574565 CGCTGGGGATGGGGGAAGCTGGG - Intergenic
905309943 1:37042408-37042430 CTCTGGGGATGGGGAGATCTTGG - Intergenic
905387591 1:37614977-37614999 CTGGGGGAATGGGGGCAGGGTGG + Intronic
905975314 1:42170009-42170031 CTGTGGGAATGGGGGGACTGAGG - Intergenic
906247457 1:44286928-44286950 CTTTGGGAATGGGGATAGGTTGG - Intronic
906979306 1:50611829-50611851 GTGTGGGTATGTGGGGAGGTTGG - Intronic
907011546 1:50968406-50968428 CCGTAGGAATTGGGGCAGCTGGG + Exonic
907720651 1:56968963-56968985 CTGTGGAACTGGGTGGAGCCTGG - Intergenic
908074178 1:60495983-60496005 CTGTGGGGGTGGGGGGAGGGTGG + Intergenic
908354830 1:63319150-63319172 CGGTGGGAATGAGGGGTGCGGGG - Intergenic
910009176 1:82439390-82439412 CTGTTGGTATGTGGGGGGCTAGG + Intergenic
910278875 1:85476486-85476508 CTGTGTGGAGGGGGTGAGCTGGG - Intronic
910758734 1:90716198-90716220 GAATGGGAATGGGGGGAGGTAGG - Intronic
910960359 1:92755654-92755676 CTTTAACAATGGGGGGAGCTTGG + Intronic
911595537 1:99794745-99794767 CTGTGGGGGTTGGGGGGGCTGGG - Intergenic
912145948 1:106794619-106794641 CTGGGGCAGTGGGGGGAGGTGGG + Intergenic
912627735 1:111220211-111220233 ATGTGGGTATGGGGAGGGCTTGG - Intronic
913549831 1:119906703-119906725 CTGTGGGAAGAGGCAGAGCTGGG + Intergenic
915153600 1:153855796-153855818 CTCTGGGACTGGGAGTAGCTGGG + Intronic
915546644 1:156602640-156602662 CTGTGGGAGTGAGGGGAGGGCGG + Intergenic
915658279 1:157380044-157380066 CTGTCGGAAGGGGAGGTGCTGGG + Intergenic
916950968 1:169780004-169780026 CTGTGGGAAGTGGTGGTGCTTGG + Intronic
917711248 1:177687602-177687624 CTGTGGGAAGTGAGGGAGGTAGG + Intergenic
918155227 1:181838389-181838411 AGGTGGGAATGGGGAGAGATTGG + Intergenic
919763638 1:201113083-201113105 CTGTAGGGATGGGAGGAGATGGG - Intergenic
919933098 1:202234335-202234357 CTGTGGGAATGGGTGGGGATAGG - Intronic
920185101 1:204154589-204154611 CTGAGGGACTAGAGGGAGCTTGG + Intergenic
920513669 1:206568499-206568521 GTGTGGGTATGCGGGGTGCTGGG + Intronic
920646387 1:207807165-207807187 CTGGGGGAGGTGGGGGAGCTGGG - Intergenic
922414014 1:225403856-225403878 CTGGGGGAACTGGGGGAGCAGGG - Intronic
922414032 1:225403901-225403923 CTGGGGGAACTGGGGGAGCAGGG - Intronic
922477520 1:225916776-225916798 CTGTGAGAAGGTGGGAAGCTGGG + Intronic
922585630 1:226733097-226733119 CTGTGTGAGTGGGGTGAGCAAGG + Intronic
923017020 1:230134712-230134734 CTGTGTGACTGAGAGGAGCTGGG + Intronic
923092057 1:230748207-230748229 CTCTGGGAATGGGGGGTGCATGG - Intronic
924839588 1:247694877-247694899 TTGTGGGGTTGGGGGGAGGTGGG - Intergenic
1062832729 10:616947-616969 CAGTGGGGATGGGGGGTGGTTGG - Intronic
1062906010 10:1180185-1180207 CTGTGGGAATCCTGGGACCTGGG + Exonic
1063449941 10:6144710-6144732 CTGCGGGACCGGGGGGATCTGGG + Intergenic
1063542784 10:6950951-6950973 CTATGGGCAGGGAGGGAGCTGGG + Intergenic
1064028668 10:11869591-11869613 CTGGGGGGATCGGGGGTGCTAGG - Exonic
1065542546 10:26784550-26784572 GGGGGGGAATGGGGGGAGCGGGG + Intronic
1065588785 10:27245084-27245106 CTGTGGGAAAGAGGTGGGCTGGG + Intergenic
1066106666 10:32162922-32162944 CTGTAGGAGAGGGGAGAGCTGGG - Intergenic
1067100828 10:43333253-43333275 CTGTGGGAGTGGGCAGAGATGGG - Intergenic
1067249407 10:44574538-44574560 CTGTGGGAGTGAGAGGAGCAGGG + Intergenic
1068276013 10:54797796-54797818 GTGTGGGCAGGGGGGGAGCGGGG + Intronic
1068451529 10:57196124-57196146 TTGTGGGGTTGGGGGGAGCGGGG - Intergenic
1069281113 10:66654935-66654957 CTGTGGGATGGGGTGGAGTTGGG + Intronic
1069625752 10:69866804-69866826 CTCTGGGAATGGGAGGAGCACGG + Intronic
1069900165 10:71702370-71702392 CTGAGGGAACGGAGGGAGCTGGG + Intronic
1069901016 10:71706717-71706739 CGGTGGGCATGGGGGGCCCTGGG + Intronic
1072341818 10:94459587-94459609 CAGGGGGGTTGGGGGGAGCTCGG + Intronic
1072486968 10:95864875-95864897 CTGTTGGGCTGGGGGGAGGTTGG + Intronic
1074099826 10:110346050-110346072 TTGGGGGAACGGGGAGAGCTGGG - Intergenic
1074301945 10:112240915-112240937 CTGTGGCGCTGGTGGGAGCTGGG - Intergenic
1075182249 10:120222141-120222163 CTGTGGGCATGGCAGGAGCTGGG - Intergenic
1075632968 10:124012217-124012239 GGGTGGGAATGGGCTGAGCTGGG - Intronic
1075945352 10:126428258-126428280 CTGTGGGTGTCTGGGGAGCTGGG + Intronic
1076277598 10:129216868-129216890 GTGTCGGAGTGTGGGGAGCTAGG + Intergenic
1076522709 10:131090929-131090951 CTGTGGGCAGGGGCGGGGCTGGG + Intergenic
1076522734 10:131091025-131091047 CTGTGGGCAGGGGTGGGGCTGGG + Intergenic
1076554933 10:131315093-131315115 CTGTGAGACTGGGGAGAGCCTGG + Intergenic
1076977924 11:189542-189564 CTGTGGGTTTGGGGGGAGGTGGG + Intronic
1077415820 11:2423837-2423859 CTGTGGGCAGGGGCGGAGCCAGG - Intergenic
1077444673 11:2585458-2585480 CTGTGGTGATGGGGTGAGCACGG + Intronic
1077466607 11:2736501-2736523 CTTTGGGGATGGGAGGCGCTAGG + Intronic
1077830271 11:5860748-5860770 GTGGGGGACTGGGGGGAGGTGGG - Intronic
1077989393 11:7390131-7390153 CTGTTGGGAGGTGGGGAGCTGGG - Intronic
1078158450 11:8818550-8818572 CGGGGAGAATGAGGGGAGCTAGG - Intronic
1080008128 11:27430894-27430916 TTGTGGGGGTTGGGGGAGCTGGG - Intronic
1080851425 11:36073509-36073531 CTGTGGGGAAGGGGGGTCCTGGG - Intronic
1081713578 11:45233407-45233429 CTGTGGGGGTGGGGAGAGGTAGG - Intronic
1083173583 11:60936494-60936516 TTGTGGGGCTGGGGGGAGGTGGG - Exonic
1083594172 11:63911145-63911167 CTGTGGGTAAGTGGGGAGCTGGG - Intergenic
1083744415 11:64727238-64727260 CTGAGGGCTGGGGGGGAGCTGGG - Intronic
1084024439 11:66438990-66439012 CTGTGGGAATGTGTGTACCTAGG - Intronic
1084194440 11:67516448-67516470 GTGTGAGATTTGGGGGAGCTGGG + Intergenic
1084805542 11:71576597-71576619 CTGTGGGAATGGCAGGTGGTGGG + Intergenic
1084934669 11:72580489-72580511 GTTTGGGAATAGGAGGAGCTGGG + Intronic
1085253530 11:75159379-75159401 CTGCGGGAATGAAGGGACCTGGG - Intronic
1087015263 11:93548597-93548619 CTGTGGGTCAGGAGGGAGCTGGG + Intergenic
1087832945 11:102839323-102839345 ATGAGAGAATGGGGGAAGCTGGG - Intronic
1088818021 11:113434606-113434628 GTGTGGGGATGTGGGGAGGTGGG + Intronic
1089058936 11:115610237-115610259 CTGTGGGAAGGGGGGGAAAGGGG - Intergenic
1089350045 11:117816995-117817017 CTGTGGGCATGGGGGCAGGAGGG - Intronic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1090075157 11:123576041-123576063 GTGTGGGCAGGAGGGGAGCTGGG - Intronic
1090463090 11:126909416-126909438 CTGTGGGTATGCTGGGAGCTGGG - Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091029155 11:132168794-132168816 CTGTAGGAAAGGGAGGAGCCCGG + Intronic
1091303593 11:134523426-134523448 CTCTGGGAATGCGGGGAGGCTGG + Intergenic
1091583113 12:1800583-1800605 GTGGGGGGATGGGGGGTGCTGGG - Intronic
1091664920 12:2412062-2412084 AGGTGGGCATGGGGGGGGCTTGG - Intronic
1091780103 12:3208294-3208316 ATGGGAGAATGGGGGCAGCTGGG + Intronic
1092040106 12:5376749-5376771 CTGTGGGTATCGGGGATGCTGGG - Intergenic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092282478 12:7108531-7108553 CTGTGGGTGTGGGAGGAGCGGGG + Intronic
1093236014 12:16609293-16609315 CTTTGGGGTTGGGGGGAGCCAGG - Intronic
1093242846 12:16698859-16698881 CTGTTGGAAAGGGTGGAGGTGGG + Intergenic
1094785086 12:33838821-33838843 TTGTGGGGTTGGGGGGAGCGGGG + Intergenic
1095372268 12:41482866-41482888 ATGAGGGAATGGGGGAAGCAGGG + Intronic
1096532210 12:52249219-52249241 CTCTGGGCATGGGGGGAGGGAGG - Intronic
1096742198 12:53702094-53702116 CTGTGGGGATAGGAGGAGATAGG - Intergenic
1097269597 12:57765908-57765930 CTGGGGGCATGGTGGGAGGTCGG - Intronic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1099136894 12:78916841-78916863 CTGTGAGAATGGGGGTACATAGG - Intronic
1100297225 12:93274237-93274259 GTGTCGGGGTGGGGGGAGCTTGG + Intergenic
1100910854 12:99360967-99360989 CTGGGGGACTGCGGGGAGGTGGG + Intronic
1101017738 12:100519369-100519391 CTGTGGGGCTGGGTGGGGCTTGG + Intronic
1103140974 12:118547963-118547985 CTGTTGGAAGGTGGGGGGCTGGG + Intergenic
1103554350 12:121757104-121757126 GTGTGGCAAGGGAGGGAGCTCGG + Intronic
1103966244 12:124641722-124641744 CTCTGGGCAAGGAGGGAGCTAGG - Intergenic
1104281956 12:127386536-127386558 GCGTGGGAGTGGGGGGGGCTGGG + Intergenic
1104731054 12:131105559-131105581 GTGTGGGCATGGAAGGAGCTGGG + Intronic
1104731754 12:131108989-131109011 AGGTGGGGATGGGGGGAGGTGGG + Intronic
1104893947 12:132152861-132152883 CAGTGTGACTGGGGGGAGTTTGG + Intergenic
1105851525 13:24340195-24340217 CTGAGGGAAGGGGAGGAGCAGGG + Intergenic
1107133044 13:36916863-36916885 CTGTGGGAGGTGGGGAAGCTGGG + Intronic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1112691872 13:101905546-101905568 CTGTTGGGAGGTGGGGAGCTAGG + Intronic
1113216559 13:108047878-108047900 CTGTGGGAAGATGGTGAGCTGGG - Intergenic
1113507212 13:110825619-110825641 CTGTGGCCATGGGTGGAGTTGGG - Intergenic
1114083243 14:19219476-19219498 CTGTGGGCTTGGGGTGAGCCAGG + Intergenic
1114538095 14:23435778-23435800 GTTTGGGAAGGGGGGGAGCCTGG - Intergenic
1114661993 14:24352621-24352643 ATGTGGGAAGGGTGGGAGCGGGG + Intergenic
1116676193 14:47908916-47908938 CTGTGGTAATGGAAGGTGCTAGG - Intergenic
1117391568 14:55267493-55267515 CTGTGGGGATAGGAGGATCTGGG + Intergenic
1118521208 14:66587782-66587804 CTGGGGGAATGGGCGGCTCTGGG + Intronic
1118544766 14:66873804-66873826 CTGTGGGAAGGGGCGGATGTGGG + Intronic
1118878222 14:69802907-69802929 CTATGGGAATTGGGTGAGCAAGG + Intergenic
1119298521 14:73552601-73552623 TTGTGGGAATGGGGGCTGGTAGG - Intronic
1119302818 14:73584788-73584810 TTGTGGGAATGGGGGCTGGTAGG - Intergenic
1119570010 14:75661569-75661591 ACGTGGGATTGGGGTGAGCTGGG + Intronic
1119709856 14:76813681-76813703 CAGTGTGTATGGGGGGTGCTGGG - Intronic
1119783733 14:77297043-77297065 TGGTGGGAATGGTGGGAACTCGG + Intronic
1120541932 14:85761502-85761524 ATGTGGGAATGAATGGAGCTTGG + Intergenic
1121095601 14:91216094-91216116 CGGGAGGAATGGGGGGAGCAGGG + Intronic
1121096947 14:91224015-91224037 CTGTGGGAGTGGGAGCATCTAGG - Intronic
1202894865 14_GL000194v1_random:1246-1268 CTGTGGGCTTGGGGTGAGCCAGG + Intergenic
1123433437 15:20237494-20237516 CGGTGGCAGTGGTGGGAGCTTGG - Intergenic
1124990129 15:34664932-34664954 ATGTGGTAATGGTGGGAGGTGGG + Intergenic
1125701565 15:41690104-41690126 GTGTTGGATTGGGTGGAGCTGGG - Intronic
1125828160 15:42693159-42693181 CCTGGGGAATGAGGGGAGCTGGG - Exonic
1125900284 15:43340045-43340067 ATGTGGGAATGAGGGGTGATGGG + Intronic
1127282095 15:57501488-57501510 CTGCGGCAATGTGGGGAGTTAGG + Intronic
1127325988 15:57895964-57895986 ATTTGGGAATGGGGAGGGCTGGG - Intergenic
1129034747 15:72642290-72642312 CTGGGGGAAGGGGGAAAGCTGGG - Intergenic
1129198141 15:73983169-73983191 CTGGGGGCATGGGGTGGGCTAGG - Exonic
1129215135 15:74094926-74094948 CTGGGGGAAGGGGGAAAGCTGGG + Intergenic
1129685303 15:77682734-77682756 CTGTGTGGATGGGGGTGGCTGGG - Intronic
1129753157 15:78080059-78080081 CTGTGGGAAAGGGAAGAGCTGGG + Intronic
1129772907 15:78214063-78214085 CTGTGGGAATGGGGGGAGCTGGG - Intronic
1130147588 15:81286148-81286170 CTGTGGGAATGTCTGGAGGTAGG + Intronic
1130548039 15:84870598-84870620 CCCTGGGAAGGGTGGGAGCTGGG + Exonic
1130700667 15:86176864-86176886 CTGTGGGAATGTGGAGTCCTGGG + Intronic
1131272758 15:90957052-90957074 CGGCGGGGATGGGGGGAGCGGGG - Intronic
1132358550 15:101192508-101192530 GTTTGGGAGTGGGGGGAGTTGGG - Intronic
1132513390 16:354663-354685 GTGTGGGAAAGGGGGTAGCATGG + Intergenic
1132671111 16:1102681-1102703 CTGCGGGAAGGCGGGGCGCTGGG - Intergenic
1132676663 16:1123880-1123902 CTGTGGGGCTGGGGGAAGCCGGG + Intergenic
1132818177 16:1845732-1845754 ATGTGCCAATGTGGGGAGCTAGG - Intronic
1132887738 16:2189871-2189893 CTGTGGGTTTGGGGGGTGCTAGG + Intronic
1133413525 16:5588198-5588220 CTGTGGGAATGGGGGGATGGGGG + Intergenic
1133953994 16:10423836-10423858 CTGTGGTAAGAAGGGGAGCTCGG - Intronic
1135462833 16:22659955-22659977 CTGTGGGAGTGGGAGGATCCCGG + Intergenic
1135843342 16:25896009-25896031 TTTTGGGAATGGGAGGTGCTGGG + Intronic
1135884107 16:26289711-26289733 AAGTGGGAGTGGGGAGAGCTGGG - Intergenic
1136534793 16:30893291-30893313 CTGTGGGAGGGTGGGGGGCTGGG + Intronic
1137334516 16:47534112-47534134 CTGTGGGGTTGGCGGGAGCCAGG - Intronic
1137761786 16:50946983-50947005 CTGTGGGGATGGGGGGCTCAGGG + Intergenic
1138352892 16:56355837-56355859 ATGTGGGAAGGTGGGGAGCGAGG + Intronic
1138551882 16:57752946-57752968 CTGTGGGAGTGGGGGGCGGTGGG - Intronic
1138557826 16:57783024-57783046 TTGTGGGAGTGGGGTAAGCTCGG + Intronic
1138673868 16:58636811-58636833 CGGTGGGAATGGGGAGAACTGGG + Intergenic
1139431413 16:66912828-66912850 ACGTGGGAATTGGGGGAGCCGGG + Exonic
1139641443 16:68294525-68294547 CTGTAGGGAAGGGGGGAGCAGGG + Intronic
1140449761 16:75061284-75061306 CTGGGGGTGTGGGGGGAGGTGGG - Intronic
1140471682 16:75218915-75218937 CTGGGGGAGCGGGGGGGGCTGGG + Intergenic
1141140844 16:81495925-81495947 CTGGGGGAGCTGGGGGAGCTGGG - Intronic
1142074244 16:88108223-88108245 CTGTGGGGATGCGGGGAGGGGGG + Intronic
1142286319 16:89172973-89172995 CTGTGGGAATGAGGGGACTCAGG - Intronic
1142290490 16:89191912-89191934 GCGTGGGGATGGGGGGAGCGCGG - Intronic
1142290498 16:89191929-89191951 ATGTGGGGGTGGGGGGAGCGTGG - Intronic
1142303053 16:89270122-89270144 CTGTGGGTATTTGGGGAGCGTGG - Intronic
1142465346 17:134007-134029 CTGTGGGTTTGGGGGGAGGTGGG + Intergenic
1142560466 17:806267-806289 CCCTGGGGAAGGGGGGAGCTGGG - Intronic
1142560484 17:806312-806334 CCCTGGGGAAGGGGGGAGCTGGG - Intronic
1143564733 17:7714798-7714820 CTGTGGGAATTGGGGTACCTGGG - Intergenic
1144788101 17:17842864-17842886 CTGTGGGGATGGGAGGAGACAGG + Intergenic
1145321050 17:21767615-21767637 CTGGAAGAATGGGGGGAGCACGG + Intergenic
1145777347 17:27538687-27538709 CTGTGGGCAAGGGAGAAGCTGGG + Intronic
1145957386 17:28863974-28863996 CTGAGGGAATGGGGTGAGGTGGG - Intergenic
1146004081 17:29149763-29149785 CTTTGGGCCTTGGGGGAGCTTGG - Intronic
1146061112 17:29607886-29607908 CTGTGGGGCTGGGGTGAGCAGGG - Intronic
1146219581 17:31006834-31006856 CTGTGGGACTTGGGCTAGCTAGG - Intergenic
1146575237 17:33985282-33985304 ATGTGTGAGTGGGGGGAGGTTGG - Intronic
1146648719 17:34592829-34592851 AGGTGGGAATGTGGGGAGGTGGG - Intronic
1146675662 17:34772257-34772279 CTGTGGGTCTGTGGGCAGCTGGG - Intergenic
1147219264 17:38919110-38919132 GTGTGGGTATGTGAGGAGCTGGG - Exonic
1147948769 17:44095509-44095531 CTGTGGGAATGGGGGTGGGGTGG + Intronic
1148051463 17:44771992-44772014 CTGGGGGCACAGGGGGAGCTGGG - Intronic
1148242614 17:46010547-46010569 GTGGGGGAATGTGGGGAGCCGGG - Intronic
1148744060 17:49908657-49908679 CTGTGGGAATGGGGAGTGGGCGG + Intergenic
1148864258 17:50620434-50620456 CTGTGGGAAGGGGCTGGGCTTGG - Intronic
1149370842 17:55992302-55992324 ATGTGGGAATTATGGGAGCTAGG + Intergenic
1149557935 17:57587553-57587575 CTTTGGGGCTGGGGGGAGTTGGG - Intronic
1151146527 17:72046671-72046693 CCACGGGAATGGGTGGAGCTGGG + Intergenic
1151669793 17:75565718-75565740 CTGCGGGACTGCGGGGAGTTGGG - Intronic
1152067895 17:78121533-78121555 GTGCGGGGATGGGGGGAGCCTGG - Intronic
1152232987 17:79124282-79124304 CTGTGTGATTGAAGGGAGCTGGG - Intronic
1152307502 17:79529831-79529853 CTGGGGGAACTGGGGGAGCTGGG - Intergenic
1152426960 17:80223198-80223220 CTCTGGGACTGGGTGGAGCCGGG + Intronic
1152494375 17:80660797-80660819 CGATGGGAATGGGGGGACCAAGG - Intronic
1152623442 17:81377647-81377669 CTGGGGGAGTTGGGGGGGCTGGG + Intergenic
1152623450 17:81377665-81377687 CTGGGGGAGTCGGGGGATCTGGG + Intergenic
1152624018 17:81380079-81380101 CGGTGGGGGTGGGGGGAGCGGGG - Intergenic
1152856449 17:82667462-82667484 CTGTGGGAGGGAGGGGTGCTCGG - Intronic
1153440382 18:5111225-5111247 CTGTGGGGGTTGGGGGAGCCTGG - Intergenic
1153441800 18:5127978-5128000 CTGTTGGGAGGTGGGGAGCTGGG + Intergenic
1153873740 18:9346147-9346169 CTAGGGGACTGGGGGGAGGTAGG - Intronic
1155077039 18:22367795-22367817 CTGTGTGTGTGGCGGGAGCTGGG + Intergenic
1155277166 18:24199376-24199398 CTGGGGGAGCCGGGGGAGCTGGG - Intronic
1155450385 18:25957323-25957345 CTGGGGGAATGTGAGGTGCTAGG - Intergenic
1156435537 18:37124428-37124450 GGGTGGGAATGGCGGTAGCTTGG - Intronic
1156449453 18:37258782-37258804 CTGGGGGAATGGGTGTGGCTGGG + Intronic
1157050074 18:44153169-44153191 CAGTGGGAATGTGTGGGGCTGGG + Intergenic
1157276107 18:46312037-46312059 GTGTGGGGTTGGGGGGTGCTCGG + Intergenic
1157727297 18:49974616-49974638 CTGTGGGAGATGGGGGAGATAGG + Intronic
1158243691 18:55406733-55406755 TTGTGGGGATGGGGGGAGGCGGG - Intronic
1159995768 18:74962492-74962514 CTGTGGGAATGGATGGGCCTAGG + Intronic
1160159754 18:76462015-76462037 ATGTGGGAAGGGTGGGAGCCAGG - Intronic
1160801862 19:974090-974112 GGTTGGGAGTGGGGGGAGCTGGG - Exonic
1160975109 19:1789276-1789298 TGGTGGGACTGGGGGGACCTGGG - Intronic
1160979816 19:1811783-1811805 CTGTGGGACGGGGGAGAGGTGGG + Exonic
1161027446 19:2043083-2043105 CTGTGAGGAGGGAGGGAGCTGGG - Intronic
1161037531 19:2093738-2093760 CTGTGGAAAGAGAGGGAGCTGGG + Intronic
1161484011 19:4525107-4525129 CTGGGGGAGCTGGGGGAGCTGGG + Intronic
1161644454 19:5444536-5444558 CTGTGGGGATGGGGGTGGCAGGG - Intergenic
1161793430 19:6373802-6373824 CTGTGGGAGGGGCGGGACCTGGG + Intronic
1162588501 19:11576211-11576233 CTGTGGGTGGGGTGGGAGCTGGG - Intronic
1162832291 19:13293077-13293099 CTGTGGGATTTGGGCAAGCTGGG + Intronic
1163791024 19:19306151-19306173 CTGTGGGCCCCGGGGGAGCTGGG + Intronic
1164539742 19:29113914-29113936 CTCTGGGAAGTGGTGGAGCTGGG + Intergenic
1165149848 19:33753932-33753954 GTGTGGGGATGGTGGGAGGTTGG - Intronic
1165720185 19:38073534-38073556 CTGTGTGAAGGAGGGCAGCTGGG - Intronic
1165953299 19:39486687-39486709 GTGTGGGAGTGGGGGGAAATGGG + Intronic
1166268175 19:41697530-41697552 CAGTGGCAAAGGGAGGAGCTGGG - Intronic
1166491706 19:43266167-43266189 CTGTGGAACTGGGGGCACCTGGG - Intronic
1167752075 19:51387450-51387472 CTGTGGGGAAGGGGAGAGATGGG + Intronic
1168075201 19:53977579-53977601 CTGTGGGGATGGGGAGAGAGAGG - Intronic
1168251733 19:55145960-55145982 CGGTGGGCAGGGGGCGAGCTGGG - Intronic
1168327020 19:55543764-55543786 GTGTGGGCATGGGTGGAGTTGGG - Intronic
924978522 2:199031-199053 CTGTGGGAATGCAGGGGGCCAGG - Intergenic
926252333 2:11162195-11162217 CTGTGTCTATGGAGGGAGCTGGG + Intronic
926589803 2:14728498-14728520 GAATGGGAATGAGGGGAGCTTGG - Intergenic
927081285 2:19633351-19633373 CTGCGTCCATGGGGGGAGCTTGG - Intergenic
927433409 2:23046429-23046451 CTGGGGGAAGGGGGAGAGGTAGG - Intergenic
927519597 2:23690874-23690896 CTGGGGAACTGGGGGGAGCAGGG - Intronic
928043117 2:27898358-27898380 TTATTGGAATGGGGTGAGCTTGG + Intronic
928215171 2:29355324-29355346 GAGTGGGAATGTGGGGACCTGGG - Intronic
928392596 2:30920906-30920928 CAGTGTGAATGTGGGGTGCTGGG - Intronic
929398130 2:41547061-41547083 CTGGGGGAATGATGAGAGCTAGG - Intergenic
929536982 2:42789965-42789987 CTCTGGGAAGGGGAGGCGCTGGG + Intronic
929732965 2:44515299-44515321 CAGTGGGACTGGGAGGAGTTAGG + Intronic
929867551 2:45731035-45731057 ATGTGGGAATAGTGGGAGCCTGG + Intronic
930846319 2:55908434-55908456 GGGTGAGAATGGGGGGAGATGGG + Intronic
931020325 2:58037430-58037452 CTATGGGAAAGGGGGCAGGTGGG + Intronic
931748049 2:65307946-65307968 CTGTGTGAATGGGGGGGGCGGGG - Intergenic
931757916 2:65390391-65390413 CTGTGGGACTGGAGTGAGCCTGG + Intronic
932484542 2:72075696-72075718 CTGAGGGAATGCGGAGAGGTGGG - Intergenic
932840075 2:75073652-75073674 CAGTGGGTCTGGGGGGAGGTGGG + Intronic
932954149 2:76331872-76331894 CTGTGACCATGGGGGAAGCTGGG + Intergenic
934859126 2:97749365-97749387 GTGTGGGAAAGGAGGGAGATGGG + Intergenic
936063451 2:109313147-109313169 CTGTGTGCATGGGCTGAGCTGGG + Intronic
938085436 2:128396769-128396791 CTGTGGGAGGGAGGGGACCTGGG + Intergenic
938493339 2:131777154-131777176 CTGTGGGCTTGGGGTGAGCCAGG - Intergenic
942189739 2:173457848-173457870 GAGTGGGAATGGGGGGAGGGCGG - Intergenic
942270299 2:174267856-174267878 CTGAGGGAATTGAGGGGGCTGGG - Intergenic
944183744 2:196926124-196926146 CTCTGGGCATGAGGGGGGCTGGG + Intronic
946137274 2:217657554-217657576 CTGTGGGCTTGGCGAGAGCTGGG - Intronic
946766997 2:223050166-223050188 ATGTGGGAATCGGGGCAGCAGGG + Intergenic
946862209 2:224011031-224011053 CTGTGGGAATGGAGGGGGAGGGG + Intronic
947916783 2:233837841-233837863 CTGGGGGAGTGTGGGGAGCAGGG - Intronic
948014454 2:234676654-234676676 CCCTGGGAATGCTGGGAGCTAGG + Intergenic
948887274 2:240890563-240890585 CTGTGGGCATAGGCGGGGCTGGG - Intronic
948904761 2:240973552-240973574 CACTGGGGATGTGGGGAGCTGGG - Intronic
948931521 2:241135334-241135356 CTGTGGGACTTGAGGGTGCTCGG - Intronic
1168805923 20:672282-672304 CTGTGGGCTTGGGGGGACCCTGG + Intronic
1169068218 20:2706386-2706408 GGGTGGGAACTGGGGGAGCTAGG - Intronic
1169119391 20:3085840-3085862 CTGTGGGAACTGCGAGAGCTGGG - Intergenic
1170455922 20:16532637-16532659 CTGTGGGAATGGGAGGAATCTGG - Intronic
1170807072 20:19641570-19641592 GTGTGGGACTGGGGAGTGCTAGG + Intronic
1171453038 20:25248849-25248871 GGGTTGGAATGGGGTGAGCTCGG + Intronic
1171768397 20:29302165-29302187 GGGGGGGAAGGGGGGGAGCTGGG + Intergenic
1172501794 20:35432936-35432958 CTGTGAGTATGGGGGTAGCAGGG + Intergenic
1173923222 20:46761601-46761623 CTGTCGGGAAGGAGGGAGCTGGG - Intergenic
1174190740 20:48738671-48738693 CTGTGGGTTTGGGGGGAGAAGGG + Intronic
1174888993 20:54369290-54369312 CTGTGGGATTGGATGGATCTCGG + Intergenic
1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG + Intronic
1175888797 20:62306985-62307007 CTGGAGGACTGGAGGGAGCTGGG + Intronic
1175905745 20:62378537-62378559 CAGTGGGAATGGCGGGATTTCGG - Intergenic
1176074083 20:63240616-63240638 CTGCGGGAGTGGGGGAAGTTTGG - Intergenic
1176104463 20:63379400-63379422 CTGTGGAGCTGGTGGGAGCTGGG + Intergenic
1176119250 20:63446582-63446604 CTGTGGGGCTGGGGGCAGATGGG + Intronic
1176614562 21:9017233-9017255 CTGTGGGCTTGGGGTGAGCCAGG + Intergenic
1177166769 21:17612637-17612659 CTGTGGGTATCGGGGGAGGGTGG - Intronic
1178600558 21:33990856-33990878 CTCTGGGAATGGTGAGAGCTGGG + Intergenic
1178947253 21:36958995-36959017 CTGTGGAACCAGGGGGAGCTGGG + Intronic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1179828794 21:43983216-43983238 CTGTGGGATGGGGGGGCGCGCGG - Exonic
1180135210 21:45857978-45858000 GTGTGGGAATGGGGGAGGCCTGG - Intronic
1180294730 22:10873791-10873813 CTGTGGGCTTGGGGTGAGCCAGG - Intergenic
1180497536 22:15903205-15903227 CTGTGGGCTTGGGGTGAGCCAGG - Intergenic
1181161140 22:20960639-20960661 CTGGAGGAACAGGGGGAGCTGGG - Intergenic
1181475392 22:23164892-23164914 CTGTGGGGGTGGGGTGGGCTGGG - Intergenic
1181985808 22:26799200-26799222 CTTTGGGAGAGGGAGGAGCTGGG - Intergenic
1182474379 22:30568465-30568487 ATCTGGGCATGGGCGGAGCTGGG + Intronic
1184498818 22:44859837-44859859 GAGTGGGGAAGGGGGGAGCTTGG + Intronic
1184796373 22:46735720-46735742 CTGGGGGAATGGGGAGGGCTGGG + Intronic
1185298069 22:50063934-50063956 CTGTGGGGTGGGGGGAAGCTGGG - Intronic
950126564 3:10513448-10513470 CCCTGGGAAGGGGGGCAGCTGGG + Intronic
950220439 3:11191403-11191425 CTATGGGAAGAGGGGGAGGTGGG - Intronic
950474442 3:13206706-13206728 CTGTGGGAAAGGAGGCAGGTGGG + Intergenic
953829034 3:46279439-46279461 CAGTGGGAATGGGGATATCTGGG + Intergenic
953901147 3:46845048-46845070 TTGTGGGAGGAGGGGGAGCTTGG - Intergenic
954413413 3:50381127-50381149 CTGGGGGGAAGCGGGGAGCTGGG + Intronic
954578826 3:51692025-51692047 CTGGGGGAAGGGAGGGAGGTGGG - Intronic
954623116 3:52006839-52006861 CTGAGGCAATGGCGGGGGCTGGG - Intergenic
955391358 3:58524657-58524679 CTCTGGGAGTGAGGGGTGCTGGG - Intronic
959950355 3:112174483-112174505 CTGTGGCAGTGGAGGGAGCGGGG + Intronic
960797799 3:121506402-121506424 CTGGGGGAATGTGAGGAGGTTGG - Intronic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
961648679 3:128406368-128406390 GGGTGGGAATGGGGAGATCTTGG + Intronic
961866999 3:129960805-129960827 CTGTTGGGATGATGGGAGCTTGG - Intergenic
962211486 3:133482846-133482868 CTGTTGGGGTGGGGGGCGCTGGG + Intergenic
962786089 3:138769127-138769149 CTGTGGAGCTGGCGGGAGCTGGG - Intronic
963052254 3:141152233-141152255 CTGTGGGAATGCAGGGAGCCTGG - Intergenic
966130586 3:176633687-176633709 CTGTGGGAATGCAGGAAGGTGGG + Intergenic
966973580 3:185066655-185066677 CTGTGGGAAGGGGTGGGGATAGG + Intergenic
968561451 4:1285250-1285272 CTCTGGGGATGAGGGGGGCTGGG + Intergenic
968715635 4:2157131-2157153 CTGTTGGGCTGTGGGGAGCTTGG + Intronic
969207226 4:5655999-5656021 CTGAGGGAAGTGGGGGAGGTAGG + Intronic
969384539 4:6835614-6835636 CTGTTGGGAGGCGGGGAGCTGGG - Intronic
969390834 4:6890281-6890303 CAGTGGGAATGGAGACAGCTTGG + Intergenic
969910710 4:10442960-10442982 CTGTAGGAATATTGGGAGCTAGG - Exonic
970970014 4:21971525-21971547 CTTTGGGTATGGTGGGAGCTGGG + Intergenic
971048335 4:22831242-22831264 CAGTGGCAATGGGGGCTGCTGGG - Intergenic
971192085 4:24437405-24437427 CTGAGGGAACGGGGGGTCCTAGG + Intergenic
971409485 4:26355168-26355190 CTGGGGGATTAGGGGGAGGTGGG - Intronic
972686233 4:41356275-41356297 CTTTGGGAGGTGGGGGAGCTGGG + Intergenic
972790548 4:42367620-42367642 CTGTGGGGATAGTGAGAGCTTGG + Intergenic
976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG + Intronic
977179505 4:93856942-93856964 CTGTGGGAATGGGTGCCGGTGGG - Intergenic
978072789 4:104492236-104492258 CTGTGGGGAGGGAGGGAGCGGGG - Intronic
979339656 4:119506954-119506976 GTGTGGGAATGAGGGGAGTCAGG - Intronic
981056115 4:140363146-140363168 CTGTGGGACTTGGGGGACATAGG + Intronic
981104448 4:140864622-140864644 CTGTGGGACTGGGGGACACTGGG + Exonic
981296713 4:143140908-143140930 CTGGGGGAAGGGGGGTGGCTGGG + Intergenic
981580096 4:146242387-146242409 GTGTGGGAAGGCGGGGATCTGGG - Intergenic
983284762 4:165725601-165725623 CTATGGGAAAGGGGAGAGCTAGG + Intergenic
983851984 4:172592408-172592430 GTGTGGGGATGGTGGGAGGTAGG - Intronic
985637998 5:1049345-1049367 CAAGGGGAATGGGGGGAGATGGG - Intergenic
985640660 5:1062071-1062093 CTGGGAGCATGGGGGGTGCTGGG + Intronic
986479861 5:8175995-8176017 CTGAGGGCATGGTGGGAGGTGGG + Intergenic
987135928 5:14899407-14899429 CTGTTGGGATGTGGGGGGCTAGG - Intergenic
988580257 5:32462672-32462694 AGGTGGGAGTGGGGGAAGCTAGG - Intergenic
988867172 5:35348191-35348213 CTGTTGGAGTGTGGGGAACTAGG - Intergenic
989188293 5:38645578-38645600 CTGTGGGAAGCTTGGGAGCTGGG + Intergenic
990736796 5:58873106-58873128 CTGTGGGAATGGGGAGGAATAGG + Intergenic
990820490 5:59834265-59834287 AGGTGGGAGTGGGGGGAGCATGG - Intronic
991021812 5:61987248-61987270 CTGTGGGGATTGAGGGAGATTGG + Intergenic
994810627 5:104514084-104514106 GTGTGGCAATGTGGGGAGTTGGG + Intergenic
995314225 5:110749507-110749529 CGGTGGGAAGGGGGGTAGTTGGG + Intronic
996540903 5:124629424-124629446 CTGAGGGGATGGTGGGGGCTGGG + Intergenic
997599931 5:135132236-135132258 CTGGAGCCATGGGGGGAGCTGGG + Intronic
997656329 5:135557566-135557588 CACTGGGAATGGAGGGGGCTGGG - Intergenic
999122298 5:149218784-149218806 CTGTGGGGATGGGGGAAGAGAGG - Intronic
999389611 5:151180613-151180635 CTGTGGCCAGGGAGGGAGCTAGG - Intergenic
1001245105 5:170100355-170100377 CAGTGGGAATAGTGAGAGCTGGG - Intergenic
1001836110 5:174834133-174834155 ATGTGGGAAGCTGGGGAGCTGGG - Intergenic
1002381371 5:178832072-178832094 CTGGGGGAGGGGGGGGAGGTGGG - Intergenic
1002421285 5:179150321-179150343 CTGTGGGAAGGGGAATAGCTGGG + Intronic
1002569935 5:180134530-180134552 GTGTGGGGATGGTGGGTGCTGGG - Intronic
1002658607 5:180773916-180773938 CTGGGGGGATGGGGGGTGCGGGG - Intergenic
1003310271 6:4964272-4964294 CGGTGGGAATCGGGGCTGCTGGG - Intergenic
1004413170 6:15400471-15400493 CTGTGGGGGTGGGGTGTGCTTGG + Intronic
1005246566 6:23892342-23892364 CTGTAGGAATGAGGGCAGCCAGG - Intergenic
1005284166 6:24306639-24306661 CTGCTGGAATGGGATGAGCTAGG + Intronic
1005312473 6:24571603-24571625 ATGTGGGAATGGGAGGTGGTGGG - Intronic
1005812895 6:29530106-29530128 CTGTGGGGTGGGGGTGAGCTGGG - Intergenic
1006277103 6:33013818-33013840 CTGCTGGAGTGGGAGGAGCTGGG - Intergenic
1006735222 6:36268554-36268576 CTGCGGGACTGGAGGCAGCTGGG - Intronic
1007473848 6:42106675-42106697 CTGGGGGAAGTGGGGGTGCTGGG + Exonic
1007726096 6:43916473-43916495 CTGTGGGAAGAGGGGCAGCGTGG + Intergenic
1008250739 6:49236849-49236871 CAGGGGGAAAGGTGGGAGCTGGG - Intergenic
1010385895 6:75279162-75279184 CTCTGGGAATAGTGGGAGATAGG - Intronic
1010570289 6:77466203-77466225 CTGTGGGAGTGCGGGGTGCCAGG + Intergenic
1012472625 6:99588967-99588989 CTGTGGGACTCCGGGGAGCGAGG + Intergenic
1013454468 6:110317745-110317767 CTGTGGGAAAGGTTAGAGCTAGG - Intronic
1013964263 6:115935886-115935908 CTGTGGGAAGGGGTGGATATGGG + Exonic
1014005235 6:116410288-116410310 TTGTGGGAAGGGAGGGAACTGGG - Intronic
1014134543 6:117873366-117873388 CTGTTGGGAGGTGGGGAGCTAGG - Intergenic
1015291690 6:131544879-131544901 CTGTTGGAAGGTGGGGAGCTAGG + Intergenic
1016695092 6:146984817-146984839 CTGTGGGCATCTGGTGAGCTGGG - Intergenic
1018184190 6:161251674-161251696 AGGTGGGAATGAGGGGAGCCAGG + Intronic
1018719688 6:166563255-166563277 CGGTGGGATGGGGTGGAGCTGGG + Intronic
1018900332 6:168048735-168048757 CAGTGGGCGTGGGGGGCGCTTGG + Intergenic
1019925247 7:4187189-4187211 CTGAGGGAGTGGGGAGGGCTGGG + Intronic
1019928107 7:4206393-4206415 CTGTGACCAAGGGGGGAGCTGGG - Intronic
1020007118 7:4788964-4788986 CTGTGGGAATGGGGGGCCCCAGG - Intronic
1021937282 7:25643781-25643803 CAGTTGGAAAGGGTGGAGCTAGG - Intergenic
1022515871 7:30974690-30974712 CTGTGGGGCTGGGGGAAGGTGGG + Intronic
1023207829 7:37770203-37770225 CTGATGGACTGTGGGGAGCTGGG - Intronic
1023494231 7:40777632-40777654 CTGTGGGTCTGGGGAAAGCTGGG + Intronic
1023689539 7:42772193-42772215 CAGTGGGAATGGAGGCAGCAAGG - Intergenic
1023920926 7:44629323-44629345 CTGAGGGAGTGGAAGGAGCTGGG + Intronic
1026913577 7:74106788-74106810 CTGAGGGGTTGAGGGGAGCTGGG + Intronic
1027054925 7:75043288-75043310 CTCTGGGAATGGGGGCACTTAGG + Intronic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1029736261 7:102467566-102467588 CTGTGGGAGTGGGGTGAGTCAGG + Intronic
1030187729 7:106779972-106779994 CTGTGGGAAAAGAGGGAGCATGG - Intergenic
1030731471 7:112994829-112994851 GTGTGGGAATGGGGAGATATTGG + Intergenic
1031584894 7:123522256-123522278 CTGTTGGACTGGGTGGGGCTTGG + Intronic
1032549598 7:132772010-132772032 CCGTGGGGATGGGGGGAACTTGG + Intergenic
1033007122 7:137578403-137578425 CTGTAGGATAGGAGGGAGCTGGG - Intronic
1033551839 7:142454728-142454750 CTGGGGGAATGGAGGAGGCTGGG + Intergenic
1033554119 7:142473661-142473683 CTGAGGGAATGGAGGAGGCTGGG + Intergenic
1033558752 7:142511181-142511203 CTGGGGGAATGGAGGAAGCTGGG + Intergenic
1034581185 7:152043915-152043937 CTGTGGTAAGAAGGGGAGCTTGG - Intronic
1034716835 7:153251219-153251241 CTGGGGGGTTGGGGAGAGCTGGG + Intergenic
1034896316 7:154878589-154878611 CTGTGGGAGTGGGAGGAGTCAGG - Intronic
1034902112 7:154914266-154914288 TGGTGGGAATGCGGGGAGCACGG - Intergenic
1035409940 7:158631522-158631544 TTGTGGGAATGTGGGAAGGTGGG - Intronic
1035519901 8:267099-267121 GTGTGGGGATGTGGGGAGATGGG + Intergenic
1036654921 8:10671809-10671831 CTGGGGAAATGGGGTGACCTGGG + Intronic
1037767262 8:21779937-21779959 CTTTGGGAAGGGGAGGGGCTGGG - Intronic
1037805950 8:22057926-22057948 CTGTGGGAATGGGGAGCCCAGGG + Intronic
1037935706 8:22913694-22913716 CGGTGTGAATGGTGGGAGTTAGG - Intronic
1038642654 8:29340148-29340170 CTGTGGCACTGGGGGGAACCGGG + Exonic
1038692264 8:29774177-29774199 CTGTGGGCATTGGGGGAGGGAGG - Intergenic
1039026163 8:33260658-33260680 CAATGGGAATTGGGGGAGCAAGG + Intergenic
1040750118 8:50695188-50695210 GTGTGTGAGTGGGGGGATCTTGG - Intronic
1041276604 8:56166363-56166385 CTGTGTTTGTGGGGGGAGCTGGG + Exonic
1043381429 8:79706305-79706327 CTCTGGGAGTGGGGAGACCTGGG + Intergenic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1044149427 8:88756112-88756134 AGGTGGGAATGGGGAGAGATTGG - Intergenic
1047345424 8:124023421-124023443 CTGTGGGAATAGAGGGAGTTGGG - Intronic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1048105791 8:131407807-131407829 GTGGGGGAATGGGGAGAGGTGGG - Intergenic
1048122813 8:131600625-131600647 CTGTTGGAGGGTGGGGAGCTAGG - Intergenic
1048461143 8:134622909-134622931 CTGTGGGACCGAGGGCAGCTGGG - Intronic
1049171755 8:141165878-141165900 CTTTGAGGATGGGGGGAGGTGGG - Intronic
1049297764 8:141852270-141852292 CTGTGGGGGTGGTGGGAGCAAGG + Intergenic
1049568426 8:143355891-143355913 GTGAGGGAATGGGGGGAGCGAGG - Intronic
1049594700 8:143477959-143477981 CTGTGGGGAGGCAGGGAGCTGGG - Intronic
1049614726 8:143571119-143571141 ATTTGGGGATGGGGGGAGATGGG - Intronic
1049865589 8:144933607-144933629 CTGTGGGCAGGAGGGGAGGTTGG - Intronic
1049963091 9:755093-755115 CTGTGGGGAAGGGTGGAGCTAGG + Intergenic
1050280240 9:4043112-4043134 CTGTGGGAAGGGGAGGGGCTGGG - Intronic
1050808030 9:9706830-9706852 GGGTGGGAATGGGGCGAGGTAGG + Intronic
1050831529 9:10019774-10019796 TTGTGGGGTGGGGGGGAGCTGGG + Intronic
1051196196 9:14565103-14565125 CTGTGGGGTTGGGGTGGGCTGGG + Intergenic
1053420148 9:37972267-37972289 CTCTGGGCATGGGAGGAACTGGG - Intronic
1053482056 9:38423439-38423461 GTGTGGGAAGGGGCTGAGCTGGG - Intronic
1055774617 9:79753909-79753931 GTGTGGGTATGGGGTGAGGTCGG + Intergenic
1057298937 9:93865466-93865488 CTGTGGGGGTGCGGGGAGCCAGG - Intergenic
1057790425 9:98120829-98120851 CTGCGGGAATGGGGAGGGCCAGG - Intergenic
1058187429 9:101871419-101871441 CTGTGGGAGTCGGGGGTGGTGGG - Intergenic
1058533631 9:105932077-105932099 CTGGAGAAATGGGGGCAGCTAGG + Intergenic
1058838328 9:108879811-108879833 CTGGGTGAATGGGGGTAGGTGGG + Intronic
1059258079 9:112948735-112948757 CTGTGGGAATCCAGGCAGCTGGG + Intergenic
1059342010 9:113602559-113602581 CTGTGGGGGTGTGGGGGGCTGGG + Intergenic
1059671178 9:116493784-116493806 CAGTGGGAGTGGGGGGATGTGGG + Intronic
1059718062 9:116932005-116932027 CTGTGAGAATGAGGGGTGGTAGG + Intronic
1061133865 9:128722550-128722572 CTGCGGCAATGGGAGGAGCAGGG - Exonic
1061371539 9:130200509-130200531 GTGGGGGGGTGGGGGGAGCTAGG - Intronic
1061544830 9:131298612-131298634 CTGCGGGAAGAGGGGCAGCTGGG - Intronic
1061804173 9:133128891-133128913 CCGTGGGGCTGGGGGCAGCTGGG + Intronic
1061927482 9:133813090-133813112 CTGTGGGAACAGGGGGTGGTTGG - Intronic
1062068161 9:134540041-134540063 CTGTGGGACAGGGAGGAGGTAGG - Intergenic
1062261109 9:135663760-135663782 CAGTGGGAAAGGGTGGAGCGGGG + Intronic
1185885285 X:3776860-3776882 CTGTAGCGATGGGGGAAGCTGGG + Intergenic
1186163865 X:6806070-6806092 CAGTGGGAATGGATGGAGATAGG + Intergenic
1186465294 X:9779962-9779984 ATGTGGGAATGGGTCGTGCTGGG + Intronic
1187287418 X:17918765-17918787 ATTGGGGAATGGGGAGAGCTTGG + Intergenic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1188292314 X:28405012-28405034 CTGTGAGAATGGGGAGTGGTAGG - Intergenic
1189244043 X:39549563-39549585 CTGTCGGGAAGTGGGGAGCTAGG + Intergenic
1189748719 X:44196574-44196596 CTTTTGGAATGGGGGCAGTTGGG - Intronic
1190311930 X:49122859-49122881 CTGTGGGGCTGGGGTGAGTTTGG - Intronic
1190481092 X:50877650-50877672 ATGGGGGAATGGGTGGAGCAAGG + Intergenic
1191659458 X:63635169-63635191 CTTTGGGGATGGGGTGGGCTGGG - Exonic
1192943807 X:75942560-75942582 TTGGGGGAATGGGGGAAGATGGG - Intergenic
1193326714 X:80186653-80186675 CTGTGAGAGGGTGGGGAGCTAGG - Intergenic
1195003745 X:100667030-100667052 ATGTGGGAAAGGGGGGTTCTGGG + Intronic
1196587761 X:117449409-117449431 CTGTTGGAGTGTGGGGAGCTAGG + Intergenic
1197503944 X:127278503-127278525 CTGTCGGCAGGTGGGGAGCTGGG + Intergenic
1197854768 X:130902987-130903009 CTGTGGGACTGAGGGGGCCTAGG - Intronic
1197906826 X:131434246-131434268 CTGTTGGAAGGTGGGGGGCTAGG + Intergenic
1198097548 X:133395051-133395073 CTGTGGGCTTGCGGGTAGCTGGG - Intronic
1198427698 X:136536241-136536263 ATGTGGGGAGGGAGGGAGCTGGG + Intronic
1199473400 X:148220038-148220060 CTTTGGGAATGGGGGTAGGGAGG - Intergenic
1199705534 X:150421862-150421884 CAGTGGGGTTGGGTGGAGCTTGG - Intronic
1199963745 X:152801038-152801060 GTGTGGGAAGGGAGGGAGGTGGG - Intergenic
1200148529 X:153940044-153940066 ATGGGGGAATGGGGGGAGTCTGG - Intronic
1200363393 X:155635034-155635056 CTGTTGGGAGGTGGGGAGCTGGG - Intronic
1201889887 Y:18930855-18930877 CTGTTGGGAGGTGGGGAGCTAGG + Intergenic