ID: 1129775772

View in Genome Browser
Species Human (GRCh38)
Location 15:78235366-78235388
Sequence ACTTCTGGCCTCCAGAGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 628
Summary {0: 1, 1: 2, 2: 45, 3: 138, 4: 442}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129775772_1129775777 15 Left 1129775772 15:78235366-78235388 CCACGGCTCTGGAGGCCAGAAGT 0: 1
1: 2
2: 45
3: 138
4: 442
Right 1129775777 15:78235404-78235426 GCGCAGGGCCACACTCCCTCTGG 0: 1
1: 0
2: 14
3: 75
4: 270
1129775772_1129775779 17 Left 1129775772 15:78235366-78235388 CCACGGCTCTGGAGGCCAGAAGT 0: 1
1: 2
2: 45
3: 138
4: 442
Right 1129775779 15:78235406-78235428 GCAGGGCCACACTCCCTCTGGGG 0: 6
1: 11
2: 26
3: 119
4: 364
1129775772_1129775780 18 Left 1129775772 15:78235366-78235388 CCACGGCTCTGGAGGCCAGAAGT 0: 1
1: 2
2: 45
3: 138
4: 442
Right 1129775780 15:78235407-78235429 CAGGGCCACACTCCCTCTGGGGG 0: 7
1: 49
2: 161
3: 334
4: 939
1129775772_1129775778 16 Left 1129775772 15:78235366-78235388 CCACGGCTCTGGAGGCCAGAAGT 0: 1
1: 2
2: 45
3: 138
4: 442
Right 1129775778 15:78235405-78235427 CGCAGGGCCACACTCCCTCTGGG 0: 1
1: 2
2: 8
3: 37
4: 221
1129775772_1129775775 -1 Left 1129775772 15:78235366-78235388 CCACGGCTCTGGAGGCCAGAAGT 0: 1
1: 2
2: 45
3: 138
4: 442
Right 1129775775 15:78235388-78235410 TTGGAAATGAAGATGTGCGCAGG 0: 1
1: 0
2: 1
3: 15
4: 187
1129775772_1129775783 25 Left 1129775772 15:78235366-78235388 CCACGGCTCTGGAGGCCAGAAGT 0: 1
1: 2
2: 45
3: 138
4: 442
Right 1129775783 15:78235414-78235436 ACACTCCCTCTGGGGGCTGTGGG 0: 1
1: 1
2: 15
3: 109
4: 521
1129775772_1129775776 0 Left 1129775772 15:78235366-78235388 CCACGGCTCTGGAGGCCAGAAGT 0: 1
1: 2
2: 45
3: 138
4: 442
Right 1129775776 15:78235389-78235411 TGGAAATGAAGATGTGCGCAGGG 0: 1
1: 0
2: 0
3: 23
4: 239
1129775772_1129775782 24 Left 1129775772 15:78235366-78235388 CCACGGCTCTGGAGGCCAGAAGT 0: 1
1: 2
2: 45
3: 138
4: 442
Right 1129775782 15:78235413-78235435 CACACTCCCTCTGGGGGCTGTGG 0: 1
1: 0
2: 8
3: 75
4: 566

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129775772 Original CRISPR ACTTCTGGCCTCCAGAGCCG TGG (reversed) Intronic