ID: 1129777757

View in Genome Browser
Species Human (GRCh38)
Location 15:78247886-78247908
Sequence CAGCTTTCTAAAATGCCAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129777757_1129777761 23 Left 1129777757 15:78247886-78247908 CCGATTGGCATTTTAGAAAGCTG No data
Right 1129777761 15:78247932-78247954 CTGCATGCCAGGACCATGCTAGG No data
1129777757_1129777762 29 Left 1129777757 15:78247886-78247908 CCGATTGGCATTTTAGAAAGCTG No data
Right 1129777762 15:78247938-78247960 GCCAGGACCATGCTAGGCCAAGG No data
1129777757_1129777759 12 Left 1129777757 15:78247886-78247908 CCGATTGGCATTTTAGAAAGCTG No data
Right 1129777759 15:78247921-78247943 TACCAAGCTTTCTGCATGCCAGG No data
1129777757_1129777764 30 Left 1129777757 15:78247886-78247908 CCGATTGGCATTTTAGAAAGCTG No data
Right 1129777764 15:78247939-78247961 CCAGGACCATGCTAGGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129777757 Original CRISPR CAGCTTTCTAAAATGCCAAT CGG (reversed) Intergenic